ID: 1098045801

View in Genome Browser
Species Human (GRCh38)
Location 12:66399199-66399221
Sequence GCTCCTGGCACGGTGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098045801_1098045808 -5 Left 1098045801 12:66399199-66399221 CCTCCCTCCACCGTGCCAGGAGC 0: 1
1: 1
2: 1
3: 22
4: 327
Right 1098045808 12:66399217-66399239 GGAGCGTTGAGTCAGCTTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 49
1098045801_1098045811 25 Left 1098045801 12:66399199-66399221 CCTCCCTCCACCGTGCCAGGAGC 0: 1
1: 1
2: 1
3: 22
4: 327
Right 1098045811 12:66399247-66399269 CCAATTCCACCTGCCTTCTCGGG 0: 1
1: 1
2: 5
3: 38
4: 250
1098045801_1098045807 -6 Left 1098045801 12:66399199-66399221 CCTCCCTCCACCGTGCCAGGAGC 0: 1
1: 1
2: 1
3: 22
4: 327
Right 1098045807 12:66399216-66399238 AGGAGCGTTGAGTCAGCTTTAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1098045801_1098045809 24 Left 1098045801 12:66399199-66399221 CCTCCCTCCACCGTGCCAGGAGC 0: 1
1: 1
2: 1
3: 22
4: 327
Right 1098045809 12:66399246-66399268 GCCAATTCCACCTGCCTTCTCGG 0: 1
1: 0
2: 4
3: 20
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098045801 Original CRISPR GCTCCTGGCACGGTGGAGGG AGG (reversed) Intronic
900002542 1:22666-22688 GCTGCTGGCACAGCGCAGGGAGG - Intergenic
900022261 1:193191-193213 GCTGCTGGCACAGCGCAGGGAGG - Intergenic
900138451 1:1128734-1128756 GGTCCTGGGAGGGCGGAGGGCGG - Intergenic
900206167 1:1432779-1432801 GCTGCTGGCACGGGGGACTGAGG + Intergenic
900461396 1:2803716-2803738 GGACCTGGCTGGGTGGAGGGAGG + Intergenic
900693860 1:3998043-3998065 ACTCCTAGCACTGTGGGGGGTGG - Intergenic
901198249 1:7452248-7452270 CCTCCTGGCAGGGCGGAGGGGGG - Intronic
901642108 1:10697898-10697920 GCTCCGGGGCCGATGGAGGGAGG + Intronic
901670186 1:10851552-10851574 GCTCCTGGCTCCGTGGGTGGTGG - Intergenic
902332379 1:15736886-15736908 GGTCATGGGATGGTGGAGGGTGG - Intronic
906422895 1:45686200-45686222 GCTCCATGCACGGGGGAGGCGGG + Intronic
906544886 1:46613783-46613805 GCTGGGGGCAGGGTGGAGGGGGG + Intronic
907258359 1:53197120-53197142 GATCCTGGGACGGCGGCGGGCGG - Intronic
908816253 1:68038284-68038306 GCTGCTGTCAAGGTGGAGGTGGG - Intergenic
909101748 1:71357482-71357504 GCTCCAGGCAGGGTGGTTGGAGG + Intergenic
911852443 1:102836424-102836446 GCTTGTGGCAGGGTGGGGGGAGG + Intergenic
912380191 1:109243358-109243380 GCTCCAGCCACGGTGGTAGGTGG - Intergenic
912557651 1:110527897-110527919 CCTCCTGGGAGGGTGAAGGGAGG - Intergenic
914322221 1:146576246-146576268 GCTCCTGGCACTCAGGAGAGAGG - Intergenic
915057629 1:153149951-153149973 TATCCTGGCATGGTGGAGGTGGG + Exonic
915130666 1:153693441-153693463 GCTTCTGGCACAGGGTAGGGAGG - Exonic
921723632 1:218500984-218501006 GCTCTTGGATCTGTGGAGGGAGG - Intergenic
921736434 1:218633682-218633704 GCTCCTGGGGCGGGGAAGGGTGG - Intergenic
922402614 1:225275803-225275825 GCTCCTGGCACAGTGGATCTAGG - Intronic
922804724 1:228379354-228379376 ACTCCTGGCAAGGGGCAGGGCGG - Intergenic
1063458759 10:6202724-6202746 GCTCCAGGCCCGGGGCAGGGCGG + Intronic
1064016307 10:11775070-11775092 GCTGATGGCAAGGTGGAGGAGGG - Intergenic
1065205991 10:23358196-23358218 GCTCCAGACACAGTTGAGGGTGG + Intergenic
1065991419 10:31013596-31013618 CTTCCTGGCACTGTGGAGGAAGG + Intronic
1066374423 10:34844488-34844510 GCTTCTGTCCCTGTGGAGGGAGG - Intergenic
1067147575 10:43704293-43704315 GCTGCTGGCCGGGCGGAGGGAGG + Intergenic
1067293452 10:44960606-44960628 TAACCTGGCACGGCGGAGGGAGG + Intronic
1068910446 10:62374132-62374154 GCTCCCGGCTGGGTGGCGGGGGG + Intergenic
1069420414 10:68241616-68241638 GCTCCAGGTACGGTGCAGTGTGG - Intergenic
1069929437 10:71872687-71872709 GCTACTGGCCTGGAGGAGGGTGG - Intergenic
1070750675 10:78962323-78962345 GCTCCAGACAAGGAGGAGGGAGG + Intergenic
1070967012 10:80536056-80536078 GGGCCTGGCGGGGTGGAGGGCGG - Intergenic
1073066028 10:100759661-100759683 GCTCCTGGCAGGGCTGAGGCAGG + Intronic
1073081640 10:100864494-100864516 GACCCTGGCAGGGTGGAGGAGGG - Intergenic
1073982350 10:109169027-109169049 GCTCATGGAATGGTGAAGGGAGG - Intergenic
1074778014 10:116780167-116780189 GCTCCAGGTATGGTGGAGGATGG - Intergenic
1075106426 10:119542795-119542817 GCGCCTGGCTAGGAGGAGGGCGG - Intergenic
1075360616 10:121829461-121829483 GCTCCTGGCAAGGCCGAGGCAGG + Intronic
1076575237 10:131461480-131461502 TCTCCTGGCATGGTGGAGAGAGG - Intergenic
1076635663 10:131880489-131880511 GCTCCAGGCAACGTTGAGGGTGG - Intergenic
1077467000 11:2738183-2738205 GCCCCTGGCTCGGTGGGGGTGGG + Intronic
1078355849 11:10630858-10630880 ACTCTTGGCACAGGGGAGGGGGG - Intronic
1078474536 11:11620127-11620149 GCTCCTGGCGGGGGGGTGGGGGG + Intronic
1079009262 11:16814979-16815001 CCTTCTGGCACTGGGGAGGGGGG - Intronic
1079361010 11:19770383-19770405 GCTCCTGGGAGGGTGGGAGGAGG + Intronic
1083332717 11:61906426-61906448 GCTCTGGGCACGGGGAAGGGTGG - Intronic
1084116990 11:67048332-67048354 GGTGCTGCCACTGTGGAGGGAGG + Intronic
1084263767 11:67994751-67994773 GCTGCTGGCAGGGCGGAGGCTGG - Intronic
1084365376 11:68694077-68694099 GCGCCTGGCATGGTGGAGGTGGG + Intergenic
1085470794 11:76756533-76756555 GGTCCTGGCTGGGTGGAGGCTGG + Intergenic
1085593699 11:77789634-77789656 GGCCCTGCCACTGTGGAGGGTGG - Intronic
1087396870 11:97610606-97610628 GCAGCTGTCACGGTGGAGGCAGG + Intergenic
1087416620 11:97864520-97864542 GCCCCTTGGAGGGTGGAGGGTGG + Intergenic
1090450004 11:126797979-126798001 GCTCCTGGAGAGGTGGAGGAAGG + Intronic
1091365473 11:135016248-135016270 GGTGCTGGCTGGGTGGAGGGTGG - Intergenic
1091375960 12:24729-24751 GCTGCTGGCACAGCGCAGGGAGG - Intergenic
1092171200 12:6374997-6375019 GCTCCAGGAAAGGTGGAGGAGGG - Exonic
1092855869 12:12673226-12673248 TCTCCTGGCAGGGTGTTGGGAGG + Intronic
1092867924 12:12780698-12780720 GCTACTGGGAAGGTGGAGGTGGG - Intronic
1095097395 12:38155828-38155850 GCGCCTGGCCCGGGGGCGGGGGG + Intergenic
1095853843 12:46839501-46839523 GCTCCTGAGATGGTGGGGGGAGG + Intergenic
1098045801 12:66399199-66399221 GCTCCTGGCACGGTGGAGGGAGG - Intronic
1100981505 12:100166137-100166159 GCACCTGGAAGGGTGGAGGCAGG + Intergenic
1102509004 12:113401901-113401923 CCTTCTGGGATGGTGGAGGGAGG - Intronic
1102509407 12:113403965-113403987 GGTCCTGGCAGGAGGGAGGGGGG - Intronic
1103708812 12:122895878-122895900 GCTCCTCGAACGGTGGCCGGAGG - Intronic
1103825491 12:123734728-123734750 GTTTCTTGCAGGGTGGAGGGGGG + Intronic
1104067382 12:125317001-125317023 GTTCCTGGCAGGGTGGTGAGAGG + Intronic
1104376614 12:128268855-128268877 GCTCCAGGTAGGGAGGAGGGTGG + Intronic
1104667197 12:130656058-130656080 GCTGGGGACACGGTGGAGGGTGG + Intronic
1104667695 12:130659008-130659030 TGTGCTGGCATGGTGGAGGGAGG - Intronic
1104747790 12:131221005-131221027 GATCCTGCCACCCTGGAGGGAGG - Intergenic
1105893758 13:24700869-24700891 GCATCTGGCACGGTGGACCGAGG - Exonic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1113588655 13:111483013-111483035 GCACCTCGCTCGGTGCAGGGGGG + Intergenic
1114674260 14:24430253-24430275 GCTCCTGGCCCGACGGAGAGGGG + Intronic
1118011710 14:61616424-61616446 GAGCCTGGCTGGGTGGAGGGAGG + Intronic
1121495652 14:94390028-94390050 GCCCCTGACACGGGGGAGGGAGG - Intronic
1122276551 14:100593701-100593723 GCCCCTGGAATGGTGGGGGGAGG + Intergenic
1122792754 14:104191280-104191302 GCTCCCTGCACAGTGGAGGTGGG + Intergenic
1122859790 14:104577408-104577430 GCTCCAGGCAGGGTCGGGGGTGG - Intronic
1122947141 14:105017161-105017183 GCTCCTGGGGAGGTGGGGGGCGG + Intronic
1123014370 14:105366767-105366789 GCTCTTGGGTGGGTGGAGGGTGG + Intronic
1123067774 14:105627017-105627039 GGTCCTGGCACCATGCAGGGTGG - Intergenic
1123091457 14:105744018-105744040 GGTCCTGGCACCATGCAGGGTGG - Intergenic
1123632919 15:22274571-22274593 GCTGCAGGCCCTGTGGAGGGAGG - Intergenic
1128301735 15:66570356-66570378 GTTCCTGGCAAGATGGAGGTGGG - Intergenic
1129884705 15:79030170-79030192 GCTCCCAGCTGGGTGGAGGGAGG - Intronic
1130690491 15:86077824-86077846 GTTCCTGGCACTGCGGTGGGGGG + Intergenic
1132450968 15:101968273-101968295 GCTGCTGGCACAGCGCAGGGAGG + Intergenic
1132548879 16:546085-546107 GCCCCTGGCAGAGTGGACGGGGG - Intronic
1132803826 16:1766658-1766680 GCCCGGGGCAAGGTGGAGGGAGG + Intronic
1132869803 16:2110883-2110905 GCCCCTGGCACGGGTGGGGGCGG + Exonic
1133060678 16:3172386-3172408 GCTCCGGGTATGGTGGAGGCCGG + Intergenic
1133380365 16:5324796-5324818 GCCTCTGGAAGGGTGGAGGGTGG + Intergenic
1133719001 16:8476816-8476838 GTGCCTGGCACAGAGGAGGGAGG - Intergenic
1134034659 16:11020571-11020593 GCTCCTGGCACTTTGGAGCTTGG + Intronic
1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG + Exonic
1135178910 16:20255924-20255946 TCTCCTTGGACGGTGGAGGATGG + Intergenic
1135561887 16:23483055-23483077 GCTCCTGGGGCCCTGGAGGGGGG - Intronic
1135992815 16:27228271-27228293 GCTGCGGGAACAGTGGAGGGAGG + Intronic
1136069493 16:27779312-27779334 GCTCTTGCCAAGGTGGATGGCGG - Exonic
1136845650 16:33573772-33573794 GCTCCTGGGACGGGGCTGGGAGG - Intergenic
1138575358 16:57904086-57904108 GCTCCTGGCAGGGCGTTGGGAGG + Intronic
1139357281 16:66374211-66374233 TCGCCTGGGACGGTGGAGGAGGG - Intronic
1139387847 16:66585744-66585766 GCTCCTGGCCTGGTGGAGGTGGG + Intronic
1139695234 16:68669600-68669622 GCTCCTGGTGGGGTGGCGGGGGG + Intronic
1140011405 16:71134922-71134944 GCTCCTGGCACTCAGGAGAGAGG + Intronic
1140332729 16:74073351-74073373 GTTCCTCACACGGTGGAGGGGGG - Intergenic
1141930241 16:87197372-87197394 GCTCATGCCACGATGGAGGCTGG + Intronic
1142217719 16:88838015-88838037 GTTCCCTGCACGGTGAAGGGTGG + Intronic
1203107358 16_KI270728v1_random:1422425-1422447 GCTCCTGGGACGGGGCTGGGAGG - Intergenic
1142631484 17:1229167-1229189 GCTCCCGGCACGGACGAGGGGGG - Intergenic
1143389604 17:6552466-6552488 GCTCCTGGGAAGCTGGAGAGAGG - Intronic
1144461675 17:15463688-15463710 GCACATGGCACAGTGGAGAGTGG - Intronic
1144549914 17:16231154-16231176 GCTCCTAGCACTTTGGAAGGCGG - Intronic
1144727031 17:17507199-17507221 GCTGCTGCCAGGGAGGAGGGAGG + Intronic
1144825950 17:18105830-18105852 GATGGTGGCACAGTGGAGGGCGG - Intronic
1144829054 17:18121615-18121637 CCTCCTGGCCAGGGGGAGGGTGG - Exonic
1145005610 17:19336118-19336140 GCTCCTGGGACTGGAGAGGGCGG - Exonic
1146267633 17:31463522-31463544 GCCTCTGGCCTGGTGGAGGGAGG - Intronic
1147300748 17:39524846-39524868 GCTCCTGGCAAGGTGGAGTCTGG + Exonic
1147583244 17:41638495-41638517 GGCCCTGGGAAGGTGGAGGGTGG - Intergenic
1148102048 17:45098209-45098231 GCTCCTTGCCTGGTGGAGTGTGG + Intronic
1148195900 17:45712547-45712569 GCACATGACACGGTGGAGGCAGG - Intergenic
1148743719 17:49907226-49907248 GCTTCTGGAAGGGTGCAGGGAGG - Intergenic
1148852638 17:50562153-50562175 GCTGCGGGGACGGAGGAGGGGGG + Intronic
1149871236 17:60183759-60183781 ACTTCTGGCTCTGTGGAGGGTGG - Intronic
1150722210 17:67622951-67622973 GCTACTGGTTTGGTGGAGGGAGG - Intronic
1151996245 17:77611102-77611124 GCTCCCTTCTCGGTGGAGGGAGG - Intergenic
1152659239 17:81534807-81534829 GCTCCTGGGGGTGTGGAGGGAGG + Intronic
1153808690 18:8733103-8733125 TCTCCTGGCAGGGGGGAGGAAGG + Intronic
1155396699 18:25393582-25393604 TCTCCAGCCATGGTGGAGGGAGG + Intergenic
1157134293 18:45038839-45038861 TCTCCTGGGAATGTGGAGGGTGG + Intronic
1157332265 18:46712543-46712565 GCTGCAGGCACAGAGGAGGGAGG - Intronic
1157369525 18:47097881-47097903 TCTCCAGTCAGGGTGGAGGGTGG - Intronic
1157492388 18:48133238-48133260 GCCTCTGGCATGGAGGAGGGAGG + Intronic
1158392952 18:57058548-57058570 GTCTCTGGCAGGGTGGAGGGGGG - Intergenic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1158648501 18:59267634-59267656 GGTCCTGGCACGGGGGGGGGGGG - Exonic
1159028781 18:63210014-63210036 GCCCCTGGTGTGGTGGAGGGTGG + Intronic
1160512453 18:79460173-79460195 GCTGCTGCCTGGGTGGAGGGTGG - Intronic
1160604986 18:80043540-80043562 GCTCCTGTCTCTGGGGAGGGAGG + Intronic
1160634294 19:64274-64296 GCTGCTGGCACAGCGCAGGGAGG - Intergenic
1160836570 19:1127346-1127368 GCTCCTGGCATGGAGTTGGGGGG - Intronic
1161028436 19:2047252-2047274 GCTCCTGGCACGGAGTGGGGTGG + Intronic
1161578460 19:5067620-5067642 GGTGCTGGCATGGGGGAGGGAGG + Intronic
1162001477 19:7747119-7747141 GTTCCTGGGAAGGTGGAGGCTGG - Intronic
1162176383 19:8832871-8832893 GCTCCGGGCCGGGCGGAGGGCGG + Intronic
1162445533 19:10720077-10720099 GCTTCTGGGACGGGGGTGGGGGG + Intronic
1162781661 19:13010018-13010040 GCCCCTGGGGCGGTGGAGGCGGG - Intronic
1163186225 19:15641335-15641357 GCTCCAGGGACAGTGGAGAGAGG - Intronic
1163509563 19:17726854-17726876 GCTCCTGGCCAGGTCTAGGGTGG - Exonic
1163705350 19:18809218-18809240 GCTCGTGGAAAGGTGGAAGGGGG + Intergenic
1165096815 19:33414060-33414082 CCTCCTGGCAGGGTGGGTGGTGG - Intronic
1165511395 19:36268608-36268630 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165511943 19:36271131-36271153 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165512495 19:36273632-36273654 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165513042 19:36276173-36276195 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165513598 19:36278728-36278750 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165514148 19:36281262-36281284 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165514700 19:36283799-36283821 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165515252 19:36286332-36286354 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165515802 19:36288868-36288890 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165516353 19:36291405-36291427 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165516905 19:36293931-36293953 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165517458 19:36296454-36296476 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165518010 19:36298989-36299011 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165518561 19:36301524-36301546 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165519110 19:36304056-36304078 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165519660 19:36306571-36306593 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165520209 19:36309099-36309121 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165623858 19:37269483-37269505 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165624403 19:37272023-37272045 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165624948 19:37274550-37274572 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165625484 19:37277088-37277110 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165626020 19:37279613-37279635 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165626564 19:37282140-37282162 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165627103 19:37284665-37284687 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165627646 19:37287189-37287211 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165628181 19:37289713-37289735 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165628722 19:37292238-37292260 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165629263 19:37294764-37294786 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165629805 19:37297289-37297311 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165630348 19:37299817-37299839 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165630884 19:37302355-37302377 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1166088724 19:40494132-40494154 GCTCCTGGGAGGACGGAGGGAGG + Intronic
1166994682 19:46714464-46714486 GCTCCTGGGAAAGTGGGGGGGGG + Intronic
1167289950 19:48619058-48619080 GCTAGGGGCACGCTGGAGGGCGG - Intronic
1167372240 19:49090140-49090162 TCCCCTGACACAGTGGAGGGAGG - Intronic
1168429522 19:56266937-56266959 GCTCATGGGAATGTGGAGGGAGG - Intronic
925077550 2:1030240-1030262 GCACCAGGCACAGTGGAAGGCGG - Intronic
925112207 2:1346267-1346289 GCGCCAGGCAGGGTGGAGGGTGG - Intronic
925979327 2:9164284-9164306 CCTCCTGGCACACTGGAGAGGGG - Intergenic
927076167 2:19580207-19580229 GATCCTGGGATGGTGGAGGAAGG - Intergenic
927095691 2:19746181-19746203 GCTCCCAGCACACTGGAGGGTGG + Intergenic
927542536 2:23926409-23926431 TCTGCGGGCGCGGTGGAGGGTGG - Intronic
927680596 2:25136613-25136635 CCTCCAGGCACAGTGAAGGGCGG + Intronic
928658410 2:33476545-33476567 CCTCCTGGCACGGTGGCGGGCGG + Exonic
929595032 2:43170444-43170466 CCTCCTGGGATGGTGGAAGGAGG + Intergenic
929603556 2:43219826-43219848 GCTGCTGGCACGGCTGAGGGAGG - Intergenic
931446728 2:62333006-62333028 AATCCTGACACTGTGGAGGGAGG + Intergenic
933651345 2:84852582-84852604 GCTGTTGGCAGGGTGGAGGAGGG + Intronic
934715670 2:96541968-96541990 TCTCCTGGCTCTGTGGAGGAGGG - Intronic
935447092 2:103168204-103168226 GCTCCTGGCAGGGCGGGGGCAGG - Intergenic
935806651 2:106754986-106755008 GCTGCTGGGGAGGTGGAGGGAGG + Intergenic
936567181 2:113590753-113590775 GCTGCTGGCACAGCGCAGGGAGG + Intergenic
937012104 2:118572110-118572132 CCTCCGGCCTCGGTGGAGGGTGG + Intergenic
937463445 2:122109393-122109415 GATCCTGGGAAGGTGAAGGGAGG + Intergenic
938206528 2:129428893-129428915 GCAACCAGCACGGTGGAGGGAGG - Intergenic
938367316 2:130745002-130745024 GCTCCTGGCAGCCTGGAGAGCGG - Intergenic
946870307 2:224078782-224078804 GCTCCTGGCACAGGCGAGGAAGG - Intergenic
947623440 2:231604957-231604979 GCTCCTGGCCCGGGGCAGGCGGG + Intergenic
948121618 2:235535161-235535183 GCGGGTGGCCCGGTGGAGGGAGG - Intronic
948249549 2:236514859-236514881 GCTCCTGGCAGCTTGGGGGGAGG + Intergenic
948874923 2:240821060-240821082 AGCCCTGGGACGGTGGAGGGAGG - Intergenic
1169217382 20:3801559-3801581 GCTGGTGCCACAGTGGAGGGCGG + Intronic
1170359808 20:15533763-15533785 GGTCCTGGGATGGAGGAGGGAGG + Intronic
1171407041 20:24918383-24918405 GGTCCCGGCACAGGGGAGGGGGG + Intergenic
1172173905 20:32960940-32960962 GCACCTGGCCTGGTGCAGGGTGG + Intronic
1172276958 20:33685249-33685271 GGGCCTGGGAGGGTGGAGGGTGG + Intronic
1172591639 20:36122107-36122129 GCACCTGGCCAGGTGGAGAGTGG + Intronic
1172876887 20:38169863-38169885 GCTGCAGGGACGGTGGAAGGGGG - Intergenic
1173563940 20:44025961-44025983 GCTCCTGGCGGGGTGGGGTGGGG + Intronic
1174276633 20:49408984-49409006 GCTCCTGGGCCTGTGGAGGCAGG + Intronic
1175191637 20:57215690-57215712 GCATCTGGCACTGTGGAGGTGGG + Intronic
1175260408 20:57670487-57670509 GATCCTGGCACCTAGGAGGGAGG - Intronic
1175516547 20:59574073-59574095 GCTGGTGGCACGGAGGAGGATGG - Intergenic
1175943563 20:62548768-62548790 TCTCCAGGCAGGGTTGAGGGGGG - Intergenic
1179245181 21:39627032-39627054 GCTGTTGGTACTGTGGAGGGGGG + Intronic
1179486527 21:41714079-41714101 GCTCATTCCACGCTGGAGGGAGG - Intergenic
1180090806 21:45533102-45533124 CCTCCTGGGAGGGTGCAGGGCGG - Intronic
1180216337 21:46325375-46325397 GCTCCCAGGAGGGTGGAGGGGGG + Intronic
1181339338 22:22165789-22165811 GCTCCTGGTGCCCTGGAGGGAGG + Intergenic
1183101800 22:35588766-35588788 TCTCCTGGCGTGATGGAGGGTGG - Intergenic
1183687288 22:39368438-39368460 GCTCCTGGCACTGCGCTGGGAGG - Intronic
1184343276 22:43897859-43897881 GCTCCTGCGAGGGTGCAGGGCGG - Intergenic
1184426065 22:44410022-44410044 GCTTCTGACCCTGTGGAGGGTGG - Intergenic
1184746565 22:46459565-46459587 CCTGCTGGCACTGTGGAGGGTGG - Intronic
1184926320 22:47642281-47642303 TCTGCTGGCACTGTGGTGGGTGG - Intergenic
1185013722 22:48331571-48331593 GCTTCTGGCACGGGGAAGGCAGG - Intergenic
1185020178 22:48369893-48369915 CCTCTTGGGAAGGTGGAGGGTGG + Intergenic
952183233 3:30941606-30941628 GCTGCTGTCACTGTGGAGGTTGG + Intergenic
952971538 3:38653870-38653892 GCATCTGGCACAGTGGAGGCAGG + Intergenic
953003182 3:38953249-38953271 GCCCATGGGAAGGTGGAGGGTGG + Intergenic
953583540 3:44178718-44178740 GCCCTTGGGAAGGTGGAGGGTGG - Intergenic
955602101 3:60656605-60656627 ACTCCTGGGGAGGTGGAGGGTGG - Intronic
964175413 3:153821891-153821913 GCTGCTAGCACTTTGGAGGGGGG - Intergenic
965341629 3:167498433-167498455 GCAAATGGCAGGGTGGAGGGGGG + Intronic
967820906 3:193837860-193837882 GCTCCTGTCACTGTGGGGGCGGG + Intergenic
968479542 4:827126-827148 GCTCCTGGCGGGGTGGGGGTGGG + Intergenic
969022286 4:4146658-4146680 GCTCCTGGCAGGGCAGAGGGTGG - Intergenic
969311883 4:6357691-6357713 GCTCCTTGTACTGTGGATGGGGG - Intronic
969681353 4:8645090-8645112 GATCCTGGCACACTGGAGCGGGG + Intergenic
969731587 4:8960735-8960757 GCTCCTGGCAGGGCAGAGGGTGG + Intergenic
970464268 4:16307349-16307371 GCACCTGTCAGGGTGGAGGAAGG + Intergenic
971966765 4:33568808-33568830 TAGCCTGGCACGGTGGCGGGCGG + Intergenic
972381969 4:38527538-38527560 GCTCATTGCACAGGGGAGGGTGG - Intergenic
973907569 4:55546689-55546711 GCTCCTGGGCTGGTGGAGGAGGG - Intronic
975144114 4:70948879-70948901 GCTCAGAGCATGGTGGAGGGAGG - Intronic
978645593 4:110927308-110927330 GCCAAAGGCACGGTGGAGGGTGG + Intergenic
979979760 4:127240285-127240307 TCTCCTGGCAGAGTGGAGGAAGG + Intergenic
980170466 4:129283620-129283642 GTTCCTGGCACTGTGGATGAGGG + Intergenic
981790916 4:148535754-148535776 GCTCCTGGCACAGAGGGGAGTGG - Intergenic
985823377 5:2176056-2176078 GCTCAGGGCAGTGTGGAGGGAGG - Intergenic
986760539 5:10876052-10876074 GTTTCTGGCAGGATGGAGGGAGG + Intergenic
990037423 5:51338614-51338636 GCTACTGGGAAGGTGGAGGTGGG - Intergenic
990285326 5:54296066-54296088 GGTCCTGGCAGGGAAGAGGGTGG - Intronic
993854753 5:93059907-93059929 GCTCCTAGCACAGTGCACGGTGG + Intergenic
996726905 5:126680487-126680509 CCTCCGGGCACTGTGGAAGGGGG - Intergenic
997266786 5:132499514-132499536 TCACCTGTCAAGGTGGAGGGCGG - Intergenic
997611223 5:135217178-135217200 TAGCCTGGCAGGGTGGAGGGGGG - Intronic
998849394 5:146339084-146339106 GCTCCTGGCAGGGTGGCAGCGGG - Exonic
1000014782 5:157266818-157266840 GCTGCGGGCACGGTGGAAGTGGG + Intronic
1001494051 5:172175493-172175515 CCTCCTGGCACCCTGGTGGGTGG - Intronic
1002158201 5:177299456-177299478 GCTCCAGGCAGCGTGGACGGAGG - Exonic
1002448138 5:179302541-179302563 GCTGCTGGCAAGGTGGAGGTTGG - Intronic
1002578885 5:180195193-180195215 GCTCCAGGGACGCTGGCGGGAGG - Intronic
1002796353 6:474068-474090 CCTCCAGGCACGGTGGTGAGGGG + Intergenic
1009960451 6:70514748-70514770 ACTCCTGGCAGGGGTGAGGGAGG + Intronic
1012130606 6:95486989-95487011 TAGCCGGGCACGGTGGAGGGTGG - Intergenic
1015449926 6:133355241-133355263 CCTCTTGGAAGGGTGGAGGGTGG - Intronic
1017124247 6:151051006-151051028 CCTCCAGGAAGGGTGGAGGGCGG - Intronic
1018825236 6:167403938-167403960 GTTCCAGGCAGAGTGGAGGGAGG + Intergenic
1018928902 6:168226632-168226654 GCCCCTTGCACTGGGGAGGGAGG + Intergenic
1019145501 6:169973122-169973144 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145532 6:169973257-169973279 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145544 6:169973311-169973333 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145556 6:169973365-169973387 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145569 6:169973419-169973441 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145586 6:169973499-169973521 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145615 6:169973632-169973654 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145621 6:169973658-169973680 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145628 6:169973685-169973707 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145634 6:169973711-169973733 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145688 6:169973952-169973974 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1019145695 6:169973979-169974001 GCCCATGTCACTGTGGAGGGTGG + Intergenic
1022329062 7:29360565-29360587 TCCCATGGCAGGGTGGAGGGTGG + Intronic
1022593164 7:31685991-31686013 GATCCTGGCAAGTGGGAGGGAGG + Intergenic
1022738538 7:33099134-33099156 TCACATGGCACGGTGGTGGGGGG + Intronic
1023985191 7:45089804-45089826 GTGCCTGGCACGGGGGAGGAGGG - Intergenic
1025019104 7:55466865-55466887 GCTCCTGGCATGGGTGAGGTGGG - Intronic
1026586529 7:71660351-71660373 GCTCCTCACACAGTGGAGGGAGG - Intronic
1026829254 7:73601060-73601082 TCTCCTGGCAGGGGGGTGGGAGG - Intronic
1026848384 7:73710165-73710187 GGTCCTGGGACAGTGGAGTGGGG - Intronic
1026858359 7:73769427-73769449 GCTCCCGGGCCGGTGGAGCGCGG + Exonic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029123768 7:98284159-98284181 GCACCAGGCAGGGTGGAGGCTGG + Intronic
1029546426 7:101212715-101212737 GCACCTGTCAGGGTGGAGGTTGG - Intronic
1032139233 7:129311571-129311593 GTTGCTGGCGCGGTGGGGGGTGG - Intronic
1034220929 7:149445683-149445705 GCACCAGGCACAGTTGAGGGTGG - Intronic
1038035329 8:23682337-23682359 GCTCCTGGGACGGTGGAGGGCGG + Intronic
1048446351 8:134496364-134496386 GCTCATGTCACAGTGGATGGAGG - Intronic
1049373480 8:142278535-142278557 GCTCCTGGCACGGTGTCTTGAGG + Intronic
1049657147 8:143803937-143803959 GCACCTGTCAGGGAGGAGGGTGG + Exonic
1049885350 9:22779-22801 GCTGCTGGCACAGCGCAGGGAGG - Intergenic
1051362448 9:16293287-16293309 GCTCCTCACATGGTGGAAGGAGG - Intergenic
1052903746 9:33817033-33817055 GAGCCAGGCACGGTGGGGGGAGG + Intergenic
1053004012 9:34592515-34592537 TCACCTGCCAGGGTGGAGGGTGG - Intergenic
1053004386 9:34594328-34594350 GCTCCTCGCCCGGGGGAGGGGGG - Intergenic
1053173954 9:35909312-35909334 CCTCCTGGCAGGGAGGAGGGTGG + Intergenic
1055294461 9:74820161-74820183 GGGCCTGTCAGGGTGGAGGGGGG - Intronic
1056118505 9:83464108-83464130 GCTCCTGGCAAGGTGATGGCAGG - Intronic
1056233048 9:84566625-84566647 GCTCCTGGGACTGCGGAGGGAGG + Intergenic
1056589947 9:87958838-87958860 GCTCCTGTCACTGTAGGGGGAGG + Intergenic
1058967104 9:110048661-110048683 CCTCCGGGCGCGCTGGAGGGCGG - Exonic
1059251543 9:112891156-112891178 GCCCCTGCCCCGGTGGTGGGGGG - Intergenic
1060197146 9:121631183-121631205 GCTCCTGGCCTGGTTGCGGGAGG + Intronic
1060818031 9:126645630-126645652 GCTGCTGGCAAGGCTGAGGGTGG + Intronic
1061078213 9:128354590-128354612 GCTCCTGGGCTGGGGGAGGGTGG + Intronic
1061841982 9:133364093-133364115 GCTCCTGGCGCCATGGAGAGAGG - Intronic
1062278597 9:135742104-135742126 GCTGCTGGCGTGGTGGAGGGTGG + Intronic
1062558483 9:137128259-137128281 GCTGCTGGCACCGGGCAGGGTGG - Intergenic
1062622259 9:137428419-137428441 GCTGGGGGCACAGTGGAGGGTGG - Intronic
1062637382 9:137498677-137498699 TCTCCTGGGTGGGTGGAGGGTGG + Intronic
1203773830 EBV:62096-62118 GCCCCTGGCCCGGCGGCGGGCGG - Intergenic
1186166308 X:6829884-6829906 GCTGCTGGCTGGGTTGAGGGAGG + Intergenic
1187692683 X:21886579-21886601 GCTCCTGACACTGTAGAGGAGGG + Intergenic
1188916716 X:35920137-35920159 GCTCCTGCCGGGATGGAGGGAGG + Intronic
1189562881 X:42209037-42209059 GCTCCTGTCACTGTGGCTGGTGG - Intergenic
1189767872 X:44390633-44390655 GCTCTTGCCACGGGGTAGGGTGG + Intergenic
1190274140 X:48889680-48889702 GCTACTTGCACGGTTGAGGCAGG - Intergenic
1190741860 X:53294018-53294040 GCTTCTGGTACAGTGGAGCGTGG - Intronic
1193637357 X:83968970-83968992 GTTCCTGGCAGGGTGGGGGTGGG - Intergenic
1194434139 X:93849143-93849165 GGCCCTGGCACGTGGGAGGGTGG + Intergenic
1199967655 X:152833351-152833373 GCTCCAGGCATGGTGGGCGGGGG - Intronic
1200101008 X:153689028-153689050 GTGCCTGGCATGGTGGGGGGAGG + Intronic