ID: 1098047044

View in Genome Browser
Species Human (GRCh38)
Location 12:66410846-66410868
Sequence GAACCTTATAGACCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098047042_1098047044 14 Left 1098047042 12:66410809-66410831 CCCAAACATAGAGAAAGATATCA 0: 10
1: 275
2: 449
3: 416
4: 720
Right 1098047044 12:66410846-66410868 GAACCTTATAGACCACCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1098047043_1098047044 13 Left 1098047043 12:66410810-66410832 CCAAACATAGAGAAAGATATCAA 0: 9
1: 286
2: 507
3: 526
4: 739
Right 1098047044 12:66410846-66410868 GAACCTTATAGACCACCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098047044 Original CRISPR GAACCTTATAGACCACCTGC AGG Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904725510 1:32544132-32544154 GAACCTTAAAAACCTCATGCTGG - Intronic
906853276 1:49276794-49276816 GAACCTTATAAACCACCTTGAGG - Intronic
907722898 1:56989683-56989705 TAACCTTATAGAAAACCTACTGG - Intergenic
919129592 1:193436469-193436491 GAAGGTTATAGAACACCGGCCGG - Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
923100130 1:230807510-230807532 GAACCATATGGAGCAACTGCAGG + Intergenic
924188159 1:241519044-241519066 GAACCTTCTACCCCACCTGGAGG + Intronic
1064737945 10:18402089-18402111 GCCCCTGATAGACCACCTGTGGG + Intronic
1064966034 10:21015992-21016014 CAACATTATAGTTCACCTGCGGG - Intronic
1071913802 10:90267637-90267659 CAACCATATAGACCATTTGCTGG + Intergenic
1075869861 10:125763403-125763425 CAACGTTATCGTCCACCTGCTGG + Exonic
1083733681 11:64667673-64667695 TGTTCTTATAGACCACCTGCAGG + Exonic
1085778267 11:79385346-79385368 GAACATTATTGACCATCTGGTGG - Intronic
1086887967 11:92225524-92225546 GAACCTTCTCATCCACCTGCAGG - Intergenic
1088688564 11:112305396-112305418 GAACCGTATTGACCACCCTCTGG + Intergenic
1089505734 11:118961000-118961022 GAGCCATAGAGACGACCTGCTGG - Intergenic
1093570138 12:20657678-20657700 GCATGTTTTAGACCACCTGCAGG + Intronic
1095762116 12:45851405-45851427 CCACCTGATAGACCACCTGAGGG - Exonic
1095814184 12:46403328-46403350 AAACCTTGTAGAACTCCTGCAGG - Intergenic
1097683903 12:62674673-62674695 AAAGCTTACAGACCATCTGCTGG + Intronic
1098047044 12:66410846-66410868 GAACCTTATAGACCACCTGCAGG + Intronic
1099537079 12:83857939-83857961 CATCCATATAGACCACCTGTAGG - Intergenic
1102116034 12:110403603-110403625 GAATGTGATAGACCACGTGCGGG - Exonic
1110779333 13:79446433-79446455 CAACCTCATTCACCACCTGCAGG + Intergenic
1112680959 13:101764249-101764271 GAAGCTTAGAGACCTCCAGCAGG - Intronic
1116835192 14:49763504-49763526 GAACCTAAGAGACCTCCTGGAGG + Intergenic
1118025334 14:61762624-61762646 CAACTTTCTACACCACCTGCGGG - Intronic
1120357644 14:83454889-83454911 GAAGCTTATATACCACCTTGAGG + Intergenic
1121526586 14:94623604-94623626 CAGCCTTATGGACCACCTGTGGG - Exonic
1131117300 15:89803241-89803263 GAACCTGTGGGACCACCTGCAGG - Exonic
1137390833 16:48080186-48080208 GAAGCTTATACAACTCCTGCTGG + Intergenic
1144909782 17:18671752-18671774 AAACCTCATGGACGACCTGCTGG - Intronic
1144931355 17:18861656-18861678 GAACGTCAGAGACCACATGCAGG + Intronic
1147860853 17:43522170-43522192 GATGGATATAGACCACCTGCTGG - Exonic
1155434748 18:25800762-25800784 GATGCTTATAGACTACCTACTGG + Intergenic
1156936705 18:42717920-42717942 GAACACTATAGACCAACTTCAGG + Intergenic
1166060363 19:40321870-40321892 GGACCTTCTAGCCCACCTGTGGG - Exonic
925812045 2:7710508-7710530 GAAGCTTATACACCACCTTAGGG + Intergenic
933367261 2:81368491-81368513 TAACCTTAAAGACAACCTCCGGG + Intergenic
935311520 2:101788344-101788366 GCACTTTATCTACCACCTGCCGG + Intronic
941423635 2:165316137-165316159 GACTCTTTTAGGCCACCTGCGGG + Intronic
945103650 2:206288231-206288253 GAACATTAAAGCCCAACTGCAGG - Intronic
946095478 2:217270722-217270744 GTTCCTTAAAGATCACCTGCTGG + Intergenic
948276413 2:236712420-236712442 GCACTTCATAGACCACCTGGAGG + Intergenic
1169208082 20:3751024-3751046 GAATCATCTAGAACACCTGCGGG + Intronic
1170721371 20:18882587-18882609 GAACCTGATAGAGCTCCAGCAGG + Intergenic
1170943219 20:20866376-20866398 GAACCTTATAAACAACCTGAGGG - Intergenic
1171196596 20:23204782-23204804 TGTCCTTCTAGACCACCTGCGGG + Intergenic
1172271501 20:33657975-33657997 CATCCTCATCGACCACCTGCGGG - Exonic
1180968667 22:19803551-19803573 GCACCTTTCAGATCACCTGCTGG + Intronic
1183342377 22:37288667-37288689 GACCCTTGTGGTCCACCTGCTGG + Intronic
952947202 3:38486318-38486340 GAACCAGATATACCACCTGATGG - Exonic
953506356 3:43489393-43489415 GAAGCTTATATACCACCTTAAGG - Intronic
955498715 3:59563035-59563057 GAACTTTATAGGCCACATTCAGG - Intergenic
961142603 3:124567686-124567708 GCACCTTAGAAACCACCTGGAGG + Intronic
970995946 4:22268242-22268264 GAAGCTTATATTCCTCCTGCAGG + Intergenic
971998205 4:33994405-33994427 GAAGCTTATATACCACCTTGAGG - Intergenic
982756449 4:159224635-159224657 GAATCTGATTAACCACCTGCTGG - Intronic
983057259 4:163112679-163112701 GAGCCTTATACCCCAGCTGCTGG - Intronic
984388831 4:179100931-179100953 GAAGCTTATAGACCATCTTCTGG + Intergenic
986215055 5:5712482-5712504 GAACTTCAGAGACCACCTGCTGG - Intergenic
986931288 5:12825625-12825647 GAAGCTCAGAGACCACCTTCAGG - Intergenic
990486203 5:56261410-56261432 GCCCCTTACTGACCACCTGCTGG + Intergenic
995247322 5:109949328-109949350 GACCCATATAGTCCACCTACTGG - Intergenic
999222280 5:149990278-149990300 TAACCTTATAAACCCACTGCAGG - Intronic
999565198 5:152851881-152851903 GAACCTGATAGAGCTCCTGGAGG + Intergenic
1004574725 6:16884582-16884604 GAAGCTTATATACCACCTTGAGG + Intergenic
1013283884 6:108663985-108664007 AAACCTCATGGACGACCTGCTGG + Exonic
1017518234 6:155177539-155177561 GAAGCTTTTAGACCACCAGGTGG + Intronic
1027616352 7:80429669-80429691 GAAGCTTATATACCACCTTGAGG + Intronic
1032326491 7:130933825-130933847 CAACACTGTAGACCACCTGCTGG - Intergenic
1034214386 7:149393970-149393992 GAAACTCAGAAACCACCTGCAGG - Intergenic
1038076740 8:24084367-24084389 GAAGCTTATAGACCATCTTGAGG + Intergenic
1040720903 8:50322527-50322549 GAAGATTATAGAACACCAGCAGG - Intronic
1042092047 8:65169022-65169044 GTAACTTATAGACTACCTGTAGG - Intergenic
1052535352 9:29739355-29739377 GAAGCTTATATACCACCTTGAGG + Intergenic
1061339609 9:129968868-129968890 GAACCATATTTTCCACCTGCAGG + Intronic
1189269409 X:39740347-39740369 GCACCTTGTAGGTCACCTGCTGG - Intergenic