ID: 1098048404

View in Genome Browser
Species Human (GRCh38)
Location 12:66426690-66426712
Sequence AAAGCTTGGTGTACCCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098048402_1098048404 -7 Left 1098048402 12:66426674-66426696 CCTAAAGAGCTGTTCAAAAGCTT 0: 1
1: 0
2: 0
3: 11
4: 229
Right 1098048404 12:66426690-66426712 AAAGCTTGGTGTACCCAAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098048404 Original CRISPR AAAGCTTGGTGTACCCAAGT AGG Intronic
903579431 1:24359686-24359708 AAGGCTGGGTGTAACCAAGCTGG + Intronic
910021708 1:82598492-82598514 AAATCTTGGTGTGTCAAAGTTGG + Intergenic
916641453 1:166732493-166732515 AAATCTTGGTGCACCAATGTTGG - Intergenic
920582943 1:207129470-207129492 GAAGCTTGTTGAACTCAAGTAGG + Intronic
923125783 1:231033338-231033360 AAAGCTTGGTTTTTCAAAGTGGG + Intronic
923921706 1:238573195-238573217 AAAGCTAGGTGTTCCCAAATAGG + Intergenic
1071812742 10:89200828-89200850 ACAGCTTTCTGTACCAAAGTTGG - Intergenic
1072073500 10:91944512-91944534 AAAGATTGGTCTACCCAGGAGGG - Intronic
1073488539 10:103837505-103837527 GAAGCTTGCTCTGCCCAAGTGGG - Intronic
1081904349 11:46657793-46657815 AAGTCTTGGTGTACCTAAGAGGG - Intronic
1092996778 12:13958503-13958525 AAAGCTGGGTGTACCCCCATAGG + Intronic
1095317549 12:40784637-40784659 AAAGCCTGGTTTGCCCAAGTTGG + Intronic
1095748775 12:45688400-45688422 AAAGCCTTGTGTACACAAGTGGG + Intergenic
1098048404 12:66426690-66426712 AAAGCTTGGTGTACCCAAGTAGG + Intronic
1103269663 12:119662604-119662626 AAAGCTTTGTCGACACAAGTGGG - Intergenic
1121184000 14:91950761-91950783 GAAGCTTGTTGTTTCCAAGTTGG - Intergenic
1123913129 15:24990316-24990338 AATGTTTGGTGTCCACAAGTGGG - Intergenic
1130217567 15:81986696-81986718 GAAGCTTGGTGGACCCCACTTGG - Intergenic
1132084944 15:98900639-98900661 AAGGATTGGTGTTCCCCAGTGGG - Intronic
1158659782 18:59376309-59376331 AAGGCTTCATGTACCCATGTGGG - Intergenic
1164289997 19:23858959-23858981 AAAGAGTGGGGCACCCAAGTGGG - Intergenic
1165053871 19:33161246-33161268 AAAGCTTGGGGTTCCAAAATGGG + Intronic
1165279748 19:34785915-34785937 GAGGCTTGGAGCACCCAAGTTGG - Intergenic
925830507 2:7889620-7889642 ACAGCTTGGTGAGCCCAAGAAGG + Intergenic
926227689 2:10979867-10979889 AAAAATAGGTGTACCGAAGTGGG + Intergenic
931689451 2:64822891-64822913 AGAGATAGGTGTACCCAAATGGG - Intergenic
939815140 2:146886331-146886353 GAAGCTTGGTTAACACAAGTTGG - Intergenic
941640614 2:167983833-167983855 AAGGCTTTGTGTATTCAAGTTGG - Intronic
946980308 2:225205979-225206001 AATAATTGGTGTACCCAATTTGG + Intergenic
1179434605 21:41351620-41351642 TAAGGGTGGTGTACCCATGTTGG + Intronic
957392567 3:79596049-79596071 ACAGCTTGGTCTACCCAAATAGG + Intronic
962744460 3:138387296-138387318 AGAGTTTGGTGTAAGCAAGTGGG + Intronic
978651335 4:111009205-111009227 AAACCTTGATTTAACCAAGTAGG + Intergenic
979147493 4:117263266-117263288 AAAGGTTCCTGTACCCAAGAGGG - Intergenic
979615639 4:122739607-122739629 AAACCTTTGTGTGGCCAAGTGGG + Intronic
979964027 4:127055779-127055801 GAAGGTTGGTGAGCCCAAGTGGG - Intergenic
981569304 4:146134582-146134604 AAACCTTCTTGTACCCCAGTTGG + Intergenic
985853760 5:2409196-2409218 AAACCTTGGTGTGTCCAAGAAGG + Intergenic
986805454 5:11304680-11304702 AAAGGGTGGTATAACCAAGTGGG - Intronic
993634108 5:90323899-90323921 AAATCTGGGTGTTCCTAAGTAGG + Intergenic
994080688 5:95706130-95706152 ATAGCTTGATGGACTCAAGTGGG - Intergenic
994081571 5:95713203-95713225 ATAGCTTGATGGACTCAAGTGGG - Intergenic
996404720 5:123094074-123094096 AAAGCCTGGTGTTCCCAACAAGG - Intronic
996964485 5:129291342-129291364 AATGCTTGGTGAAGCCAAGATGG - Intergenic
997842901 5:137258202-137258224 ATAGCTGTGTGTACCTAAGTGGG - Intronic
999682914 5:154076462-154076484 GAATCTTGCTGTACCTAAGTGGG - Intronic
1002877900 6:1227289-1227311 AAACCTTGGGGTATACAAGTTGG - Intergenic
1003031016 6:2600628-2600650 ACAGCTTGGTGTAGCCAGGTTGG - Intergenic
1005170541 6:22980271-22980293 AAAGCATGGTTTTCCCAACTGGG - Intergenic
1006670616 6:35727869-35727891 CAAGCCTGGGGTACCCAAGCAGG + Intronic
1014140940 6:117941109-117941131 AAGACTTGGTGTCCCCATGTTGG + Intronic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1018763759 6:166913040-166913062 GCAGCTTGGTGAACACAAGTAGG - Intronic
1028250246 7:88531635-88531657 AAAGTTGGGTTTAACCAAGTGGG + Intergenic
1032443298 7:131958970-131958992 AAAGCCTGGTCTTCCCAAGGAGG - Intergenic
1037062205 8:14528498-14528520 AAAGCTAGGTGTAACAAAGTTGG - Intronic
1039165842 8:34679288-34679310 AAAGATTGGAGTACCCAGTTAGG - Intergenic
1042212486 8:66394636-66394658 ACAGCTTGGTCTTCCCAAGCAGG + Intergenic
1042465126 8:69120933-69120955 AATGCTGGGTGTTTCCAAGTAGG + Intergenic
1043987059 8:86706224-86706246 AAAGATTGCTGTACCTAAGGAGG + Intronic
1046565213 8:115890917-115890939 AATGCTTACTGTATCCAAGTCGG - Intergenic
1049443450 8:142619502-142619524 AGTGCTTGGTGTTCCCAAGGTGG + Intergenic
1050264904 9:3879732-3879754 AAAGCTGTGTGTACCCAAGAAGG - Intronic
1052017578 9:23486922-23486944 TAAGCCTGGTGTACCCAAGCTGG + Intergenic
1052234923 9:26199713-26199735 AAGGCTTGGTCTAATCAAGTGGG - Intergenic
1054371992 9:64409607-64409629 AAAGATTGATTTACCCAATTTGG - Exonic
1054679611 9:67899319-67899341 AAAGATTGATTTACCCAATTTGG - Exonic
1055879494 9:80982963-80982985 AAATGTTGGTGCATCCAAGTTGG - Intergenic
1058110335 9:101026023-101026045 AAAGCTTGGTATTCCAATGTAGG + Intergenic
1058339956 9:103882744-103882766 AAATCTTGGATTATCCAAGTGGG - Intergenic
1059443098 9:114321852-114321874 AAAGCTTAATGGACCCAAGATGG - Intergenic
1188086045 X:25902891-25902913 AGAGCATGGTTGACCCAAGTTGG + Intergenic
1196123415 X:112074660-112074682 AAATCCTGGTGTGGCCAAGTAGG - Intronic