ID: 1098058263

View in Genome Browser
Species Human (GRCh38)
Location 12:66532542-66532564
Sequence CAAGTGCAGCATAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098058263_1098058269 27 Left 1098058263 12:66532542-66532564 CCTACCTCATTATGCTGCACTTG 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1098058269 12:66532592-66532614 ATGTTAACAGACACAAGCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 278
1098058263_1098058267 4 Left 1098058263 12:66532542-66532564 CCTACCTCATTATGCTGCACTTG 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1098058267 12:66532569-66532591 TGTGACTTACTTTTGCCACTAGG 0: 1
1: 0
2: 8
3: 97
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098058263 Original CRISPR CAAGTGCAGCATAATGAGGT AGG (reversed) Intronic
903143674 1:21355976-21355998 CAATTGCAGGATATTGAGGAGGG + Intergenic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
905431842 1:37930453-37930475 CAATGGCAGCAGAAAGAGGTGGG - Intronic
907082761 1:51639502-51639524 CAAGGGTAGCATATTGAGTTGGG + Intronic
909205565 1:72752683-72752705 CAAGTGAAGCATTTTGAGATAGG + Intergenic
910248300 1:85166504-85166526 CAAGTCCAGCAAGATGAGGTAGG + Intronic
910751310 1:90634134-90634156 CAAGTGCAGCCCAATGGGGTGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917418329 1:174834856-174834878 TAAGTGCTGGAAAATGAGGTTGG + Intronic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
920632983 1:207670214-207670236 CAAGTGCATCATGATGATGGCGG - Intronic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
923384377 1:233452086-233452108 CAAGGCCAGCAGACTGAGGTAGG + Intergenic
924637254 1:245799911-245799933 CCAGTGCTGCAGCATGAGGTGGG - Intronic
1069103453 10:64353612-64353634 CAATTGCAGCATAGTGGGGCTGG + Intergenic
1073805702 10:107095392-107095414 TACATGCAGCATGATGAGGTGGG - Intronic
1074338640 10:112604229-112604251 AAAATGGAGCATAAAGAGGTTGG - Intronic
1077625267 11:3765865-3765887 CACATGCAAAATAATGAGGTTGG - Intronic
1079373188 11:19869690-19869712 CAGGTGCAGCCTAATGAGCTTGG - Intronic
1082110071 11:48264504-48264526 GAAGTGCAGGATGATCAGGTAGG - Exonic
1085524431 11:77156074-77156096 CCAGTGCTGCATCATCAGGTGGG + Exonic
1087236668 11:95727141-95727163 CAAGTGCAGCAGGAAGGGGTGGG - Intergenic
1089534348 11:119151357-119151379 CCAGTACAGCAGAATGAGGCTGG - Intronic
1091495938 12:972850-972872 CAACTGGAGCAGAATGAGCTAGG + Intronic
1092191996 12:6528074-6528096 CAAGTTCTGCATGATCAGGTAGG + Exonic
1095115014 12:38343232-38343254 CAGGTGCCACATAATGATGTCGG - Intergenic
1096424951 12:51493181-51493203 CAAGTGCAGTATAATAATGTCGG + Intronic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1098235664 12:68415806-68415828 ACACTGAAGCATAATGAGGTAGG - Intergenic
1100915019 12:99410767-99410789 CCAGTGCAACATAAAAAGGTAGG + Intronic
1101997586 12:109535955-109535977 CAGGTGCAGGAGCATGAGGTGGG - Exonic
1110954248 13:81534222-81534244 CATGTGCAGAAGAATGAGATTGG + Intergenic
1111664098 13:91245498-91245520 CAAGAGCAGCAGAGTGTGGTTGG - Intergenic
1116008471 14:39323194-39323216 TAAGTGAAGCAAAATGAGGGTGG - Intronic
1116274653 14:42816634-42816656 CAAATGCAGAATAATGAAATTGG - Intergenic
1116931957 14:50699750-50699772 CAAATACATCATAATCAGGTAGG - Intergenic
1121692491 14:95887918-95887940 CAAGTGCAGCAGAATCTGGGAGG - Intergenic
1122188349 14:100019560-100019582 AAAGTGCAGAAAAATGAGGCGGG - Intronic
1126366440 15:47899404-47899426 CAAGGCCAGTATATTGAGGTTGG - Intergenic
1128667563 15:69549620-69549642 CATGTGCAGAGTAATGAGATAGG + Intergenic
1133762708 16:8812655-8812677 CAAGCACAGCAGAATGAGGCTGG + Intronic
1137908830 16:52354600-52354622 CAAGTGCAGCAGAAAGAGGGAGG - Intergenic
1138346011 16:56320666-56320688 CAGGTGCGGAATGATGAGGTGGG + Intronic
1139770690 16:69273852-69273874 TAAGTGCACCCTAATGAGATAGG + Intronic
1140397276 16:74638790-74638812 CATGTGCAGCTTAATGATGTGGG + Intronic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1147431271 17:40372185-40372207 CAAGTCCAGGATCATGAGGCTGG - Intergenic
1149185746 17:53995406-53995428 CAAGAGGAGCCTAAGGAGGTGGG + Intergenic
1155210504 18:23596487-23596509 GAAGTGAAACATAATGAGGAAGG - Intergenic
1158139437 18:54241637-54241659 CAAGTCTAGCTGAATGAGGTGGG + Intergenic
1159872009 18:73768917-73768939 CAAATGCAGCATGGTGAGATGGG - Intergenic
1160199607 18:76785621-76785643 CATGTGCACCATAATGAGTGAGG - Intergenic
1161234317 19:3190357-3190379 CGGGTGCAGCACAAGGAGGTGGG - Intronic
1163219346 19:15903209-15903231 CCAGGGCAGCATAATGCTGTAGG + Intergenic
1166641278 19:44497391-44497413 CAAGTACAGCATGAAGATGTAGG + Intronic
925652814 2:6109882-6109904 CAAATGCAGCAAAAGGAGGCAGG - Intergenic
929318998 2:40517374-40517396 CATGTGCAGAAGAATGAAGTTGG - Intronic
929373673 2:41257856-41257878 CAAAAGCAGCATAGTGTGGTAGG + Intergenic
932069450 2:68603416-68603438 AAAATGCAAAATAATGAGGTTGG + Intronic
937577733 2:123444509-123444531 CAAGGCCAGCAGACTGAGGTGGG + Intergenic
937795974 2:126020669-126020691 CATCTGCAGAATAATGAAGTTGG - Intergenic
940164642 2:150756673-150756695 AAAGTACAGCATAATGAGTATGG - Intergenic
941582374 2:167315465-167315487 CAAGTGGAGGATAATAAAGTTGG - Intergenic
942266983 2:174238022-174238044 CAAGTGCTGCATAATGATGTTGG - Intronic
942271955 2:174285128-174285150 CAAATGCAAAATAATGAAGTTGG + Intergenic
943083177 2:183281294-183281316 GAAGTGCAGCATAGTGTAGTGGG + Intergenic
944663851 2:201942785-201942807 CAAGTGGAGAACACTGAGGTGGG + Intergenic
944809518 2:203314357-203314379 CTAGGGCAGGAGAATGAGGTGGG + Intergenic
946475354 2:220001468-220001490 CATTTGCAGTATAAAGAGGTTGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
1170303213 20:14908926-14908948 TAAGTGCAGCTTCATGAGGAAGG + Intronic
1174187113 20:48714031-48714053 CATGTGCAACAAAATGAGGCTGG + Intronic
1175170631 20:57078096-57078118 CAAGTGCAAAAGAATGAAGTTGG - Intergenic
1177913828 21:27062944-27062966 CAGCTGCAGCATAAGCAGGTGGG - Intergenic
1177996065 21:28099445-28099467 CAAGTCCAGCACAGTGTGGTTGG + Intergenic
1178724639 21:35040254-35040276 AAAGTGCAGCAAACTGTGGTTGG + Intronic
949815295 3:8051952-8051974 CAAGAGGAGCATAATTAGGCTGG + Intergenic
949893500 3:8751577-8751599 CAAGTGCAAAAGAATGAGGTTGG - Exonic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
955169180 3:56546549-56546571 CAAGAGGAGAATAATGAGATTGG + Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
957497689 3:81011427-81011449 AAGGTGCAGCCTACTGAGGTAGG - Intergenic
960151350 3:114251778-114251800 CAAGTTCAGCAGCATCAGGTTGG + Intergenic
961404215 3:126667331-126667353 CAAGGGCAGCATCACAAGGTAGG + Intergenic
962028167 3:131571058-131571080 CAACTTCAGCATAACGAGATAGG - Intronic
968141836 3:196264457-196264479 CAAGTTCAGAATCATGAAGTAGG - Intronic
968527226 4:1066988-1067010 CACCTGCAGAATAATGAAGTTGG - Intronic
969616438 4:8255618-8255640 CAAGTGCACCAGAAGCAGGTGGG + Intergenic
970061711 4:12040891-12040913 GAAGTGAAACATACTGAGGTGGG + Intergenic
970942070 4:21646170-21646192 CAAGTGGAGGATAATAATGTAGG - Intronic
976727099 4:88225435-88225457 AGAGTGAAGCATGATGAGGTTGG + Intronic
978922533 4:114201486-114201508 CAATGGCAGCATAGTGAGGAGGG - Intergenic
982665230 4:158252881-158252903 TAAGTGGAGCAAGATGAGGTTGG - Intronic
986365558 5:7026393-7026415 CACATGCAAAATAATGAGGTTGG + Intergenic
986500573 5:8394985-8395007 CACGTGCAACAGAATGAAGTTGG + Intergenic
987457459 5:18164975-18164997 CAAGGGCAGAATAATAGGGTTGG - Intergenic
989160324 5:38384726-38384748 CAAGTGCAGTAGAATGAGCCTGG - Intronic
989390206 5:40892454-40892476 CAAGTGCAAAAGAATGAAGTTGG + Intergenic
990276409 5:54201665-54201687 CAAGTACAGCATGGGGAGGTAGG - Intronic
990326097 5:54676741-54676763 CAAGTGCTGCAAGTTGAGGTTGG + Intergenic
994670629 5:102757441-102757463 CAAGTGCACCTTGATGAAGTAGG - Intronic
995395456 5:111681961-111681983 CAAGCGCAGCGTTATGAGGCAGG - Intronic
995414647 5:111895532-111895554 CCAGTGCAACATAATGAGTGAGG + Intronic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
999054800 5:148562898-148562920 CAAGTGAAGCATGATGTAGTAGG - Intronic
999382376 5:151130622-151130644 CCAGTGTGCCATAATGAGGTTGG - Intronic
999544675 5:152614248-152614270 CATTTGCAACATAAAGAGGTTGG + Intergenic
1000918657 5:167112909-167112931 CAAGTGCATCATAATCAAATTGG + Intergenic
1001918552 5:175582199-175582221 AAAGTGGAGCATCATGAAGTAGG - Intergenic
1001925313 5:175631691-175631713 CAAATGAAGCACAAAGAGGTGGG - Intergenic
1002855306 6:1031752-1031774 CACGTGCAGAAGAATGAAGTTGG - Intergenic
1004611934 6:17250237-17250259 GAAGTGGAGCATAATGAGGGAGG + Intergenic
1006324460 6:33342940-33342962 CAAGTGCAGCAGATGTAGGTTGG - Intergenic
1006743159 6:36323505-36323527 CAAGTCCAGCAGGAAGAGGTGGG - Exonic
1007497243 6:42268583-42268605 CAAGTGCTGCATCATGGGTTGGG + Exonic
1008112631 6:47509481-47509503 GAAGTGCAGTAAAACGAGGTAGG + Intronic
1008136210 6:47780105-47780127 CAAACCCAGCATTATGAGGTAGG - Intergenic
1009723834 6:67510404-67510426 CAAGTGAAGAAGCATGAGGTAGG - Intergenic
1010048341 6:71473518-71473540 GAAGTGCAGAATAATGGGGGTGG - Intergenic
1010788732 6:80037709-80037731 CAACTGCAGCAAAACGAGTTGGG - Intronic
1014280674 6:119440198-119440220 GAAGTGCAGCTGAAGGAGGTGGG - Intergenic
1014728691 6:125005134-125005156 CCATTGCAACATTATGAGGTGGG - Intronic
1014860963 6:126468088-126468110 CAAGTGGAGCCTAAAGAGATAGG + Intergenic
1019230612 6:170558483-170558505 GAAGTGCAGTAAAGTGAGGTGGG - Intronic
1019351253 7:555056-555078 GAAGTGCAGGAGAAAGAGGTAGG - Intronic
1020929831 7:14378991-14379013 AAAGTAAAGCATAATGAGATTGG + Intronic
1022040440 7:26576371-26576393 TCAGTACAACATAATGAGGTAGG + Intergenic
1022089321 7:27097213-27097235 GACGTGCAGCAGAATGAGGAAGG - Intergenic
1023450758 7:40282537-40282559 CAGATGCAGAAGAATGAGGTTGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1030499148 7:110337542-110337564 CAGGTAAAGCTTAATGAGGTAGG - Intergenic
1030810147 7:113961994-113962016 CAAGTGCAGTAAAAAGAGGAGGG - Intronic
1032361173 7:131256496-131256518 CAATGACAGCATAATGAGGTGGG + Intronic
1032513018 7:132486917-132486939 CAAGTGCAGCACCATGAGTTTGG - Intronic
1034396676 7:150831282-150831304 CAAGGGCAGTATAGTGTGGTAGG + Intronic
1034852588 7:154508927-154508949 CATGTGCAAAATAATGAAGTTGG + Intronic
1035742841 8:1941913-1941935 CATGTGCAGAAGAATGAAGTTGG + Intronic
1037108507 8:15138428-15138450 CAAGGGCAGAATAATATGGTTGG + Intronic
1039266729 8:35832719-35832741 GAAGTGCAGTAAAATGAGGTAGG - Intergenic
1039629269 8:39091156-39091178 CAAATACAGAATAATGATGTTGG - Intronic
1040466117 8:47696917-47696939 CACCTGCAGCATCATGGGGTTGG + Intronic
1041706840 8:60855481-60855503 AAAGTTCAGCATTATGAAGTGGG - Intronic
1042174847 8:66028784-66028806 CGAGTGCAGAGAAATGAGGTTGG - Intronic
1044743523 8:95351123-95351145 CATGGGCAGCATAAGGAGATTGG + Intergenic
1045894035 8:107192774-107192796 CAGGGGCAGCAAGATGAGGTAGG + Intergenic
1046697181 8:117355299-117355321 CAAACACAGCATATTGAGGTAGG + Intergenic
1047608397 8:126497056-126497078 CAATTGTATCATAATGGGGTTGG - Intergenic
1047821732 8:128528592-128528614 CATCTGCAGTATCATGAGGTTGG - Intergenic
1048054424 8:130849755-130849777 CGAGTGCAGCATAATCAGAATGG + Exonic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1057332085 9:94124951-94124973 CACATGCAGAATAATGTGGTTGG - Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1059472460 9:114516376-114516398 CAACTGCAATACAATGAGGTGGG + Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG + Intronic
1059603904 9:115812391-115812413 TAGGTACACCATAATGAGGTAGG + Intergenic
1060711012 9:125864028-125864050 CAATTGAAGGATAATGAGGAAGG + Intronic
1187611619 X:20949810-20949832 CATGTTCAGCATTATGAGGAAGG - Intergenic
1188966153 X:36554928-36554950 CAAGTGAAGAATAATGGAGTGGG - Intergenic
1191836851 X:65472617-65472639 CACATGCAGAATAATGAAGTTGG - Intronic
1193181513 X:78463734-78463756 CAAATGCAAAATAATGAAGTTGG - Intergenic
1193867109 X:86746897-86746919 CAAATGCAAAATAATGAAGTTGG - Intronic
1194725988 X:97398071-97398093 GAAGTTCAGTAGAATGAGGTCGG - Intronic
1195525647 X:105886889-105886911 CACATGCAAAATAATGAGGTTGG + Intronic
1196249580 X:113444990-113445012 CAAATGCAAAATAATGAAGTTGG + Intergenic
1196569080 X:117244639-117244661 AAACTGCAGCATAAGGAGTTAGG + Intergenic
1200315253 X:155125605-155125627 CACGTGCAAAATAATGAAGTTGG + Intronic