ID: 1098059384

View in Genome Browser
Species Human (GRCh38)
Location 12:66544083-66544105
Sequence CTAGATTTTCAGGATTCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098059384 Original CRISPR CTAGATTTTCAGGATTCAGC CGG (reversed) Intronic
904902891 1:33871348-33871370 CTGGACTTTGAGGATACAGCTGG + Intronic
905576307 1:39047427-39047449 CTATATTTTTAGGACTCTGCTGG + Intergenic
906672078 1:47663586-47663608 CATGATTTTCATCATTCAGCAGG + Intergenic
907230453 1:52993599-52993621 CTAGATATTTTGGATACAGCAGG - Intronic
908225243 1:62049734-62049756 ACATATTTTCAGGATTCTGCAGG + Intronic
908472616 1:64458975-64458997 CTAAATTTTGAAGATTCAGTTGG - Intergenic
910025809 1:82650172-82650194 ATAGACTTTTAGGACTCAGCAGG + Intergenic
915074256 1:153295852-153295874 CTAGATTTTCAGGTTTCCTTTGG - Intergenic
917223654 1:172758853-172758875 CAAAATTTTTAGGATTCATCAGG + Intergenic
917971864 1:180213541-180213563 CCAGATTTTCAGGCTCCAGCCGG + Intergenic
922026358 1:221752998-221753020 CCAGATTTCCAAGATTCAGTAGG + Intergenic
924013313 1:239691206-239691228 TAAGATTTTCAGGAAGCAGCTGG + Intronic
924737042 1:246767550-246767572 GTAGATTTTCACGAATGAGCTGG + Exonic
1063251871 10:4282564-4282586 CTGGATCTTCAGGATGCGGCAGG + Intergenic
1063279983 10:4617690-4617712 CTAGATTCCCAGGAATAAGCTGG + Intergenic
1065475344 10:26130813-26130835 TTACATTTTCAGCATTCACCTGG - Intronic
1065526834 10:26630909-26630931 CTACATTTTCAGCATTCACCTGG - Intergenic
1066621928 10:37364806-37364828 CTAGTATTTCAGCATTCAGTAGG + Intronic
1070487311 10:76943208-76943230 CTACCTCTTCAGGATGCAGCTGG + Intronic
1073085689 10:100887174-100887196 CTGGATTTGCAGGAAACAGCTGG - Intergenic
1074247704 10:111711713-111711735 CCAGATATTCAGGCTCCAGCAGG - Intergenic
1075467506 10:122662555-122662577 CGAGGATTTCATGATTCAGCTGG + Intergenic
1076481324 10:130786858-130786880 CCAGGCTTTCAGGTTTCAGCAGG + Intergenic
1077933439 11:6757607-6757629 CTAGTTGTTCAGCATTCTGCAGG + Intergenic
1079744653 11:24109204-24109226 CTAGGTTTTCAACATTTAGCCGG - Intergenic
1080571456 11:33560591-33560613 ATAGATTTTGAAGATGCAGCAGG + Intronic
1080758906 11:35228823-35228845 CTAGAGTTTTCTGATTCAGCAGG + Intronic
1081168111 11:39831689-39831711 CTGGCTTTTCAGGTTTCACCTGG + Intergenic
1081651189 11:44825142-44825164 TTTGATATTCAGGAGTCAGCAGG - Intronic
1082773468 11:57227685-57227707 TGAGATTCTTAGGATTCAGCTGG - Intergenic
1083827299 11:65210999-65211021 CCAGCCTTTCAGGATTCAGGTGG - Intronic
1088235673 11:107720391-107720413 ATAGATTTTCATGATTCTTCAGG - Intergenic
1089144249 11:116312937-116312959 CACCATTTGCAGGATTCAGCTGG + Intergenic
1092580666 12:9837545-9837567 CCAGATTTTCAGGATTATGTGGG + Intronic
1094036006 12:26072844-26072866 ATAAATTTTCAGGATTCATTGGG + Exonic
1095546645 12:43379191-43379213 CTAGATTTTTAGCACTGAGCAGG - Intronic
1097366285 12:58717279-58717301 CAAGAATTTCTAGATTCAGCTGG + Intronic
1097400121 12:59118371-59118393 CTAGTTTTTCAGGTTTTATCAGG - Intergenic
1097598762 12:61666676-61666698 GTAGATTTTCAGGATCCACTAGG + Intergenic
1098059384 12:66544083-66544105 CTAGATTTTCAGGATTCAGCCGG - Intronic
1103979037 12:124724132-124724154 CTTGGTTTTCAGGAGTCAGGTGG - Intergenic
1104393295 12:128409354-128409376 CCTGATTTACAAGATTCAGCTGG - Intronic
1106374046 13:29166539-29166561 ATAGATGTTCAGGATTTAACTGG + Intronic
1107126634 13:36853730-36853752 CTAGGGTTTCAGGAATCAGTGGG - Intronic
1108672126 13:52702004-52702026 CTAGATTTTCAAGGATGAGCAGG - Intergenic
1109415577 13:62034810-62034832 CTAAATGTTCAGAGTTCAGCAGG - Intergenic
1112185964 13:97127978-97128000 CTAGATTTTCAGGTTTCTGTAGG + Intergenic
1112416640 13:99208439-99208461 CTAGGTTCTCAGGATTCAATAGG + Intronic
1113192495 13:107765810-107765832 CTAGATTTTGAAGATTCTGAAGG + Intronic
1116388950 14:44368030-44368052 AAAGACTTTTAGGATTCAGCAGG + Intergenic
1116648651 14:47562306-47562328 CTAGATCTTCTTGATACAGCTGG + Intronic
1118740090 14:68733193-68733215 CTACATTTTCAGGAAGCTGCTGG + Intergenic
1121736663 14:96222742-96222764 CTAGATTTTGAAGAGTTAGCAGG + Intronic
1122696119 14:103553308-103553330 TTAGGTTTAAAGGATTCAGCTGG - Intergenic
1128165568 15:65461429-65461451 CTAGATTTTAAAGATTAGGCTGG - Intronic
1129187967 15:73922249-73922271 CTAGATTTGCAGGTCTCTGCTGG + Intergenic
1130431729 15:83855247-83855269 CTAGATTTTCAGGAATATGTTGG + Intronic
1133392573 16:5422080-5422102 CTAGATTTTCAGGAGCAAGATGG - Intergenic
1135561460 16:23479869-23479891 CTAGTCTTTCAGAATCCAGCAGG - Exonic
1138226374 16:55298947-55298969 CTAGATTTTGAGGATTCCTTTGG + Intergenic
1138470459 16:57230775-57230797 CTTGCTTTTCAGGAGGCAGCTGG - Exonic
1141274977 16:82579236-82579258 CTAGATTTTCAAGATAGAGATGG + Intergenic
1141316496 16:82967439-82967461 CTAGGTGTTGAGGATTCAGCGGG - Intronic
1143149439 17:4798415-4798437 CTAGAATCCCAGGATTCAGGCGG - Exonic
1145015031 17:19390995-19391017 GGAGCTTATCAGGATTCAGCGGG + Intergenic
1146192885 17:30785706-30785728 CAAGAATTTCAGGCTGCAGCGGG + Intronic
1146592072 17:34136008-34136030 CTAGTTTTTCAGGTTTCTCCAGG - Intronic
1149453473 17:56768188-56768210 CTAAATGTGCAGGAATCAGCTGG - Intergenic
1150689011 17:67347211-67347233 CTATAATTTAATGATTCAGCTGG - Exonic
1156514371 18:37667785-37667807 CTTGTTTTCCAGGGTTCAGCTGG + Intergenic
1158127828 18:54121626-54121648 CAATATTTTCAGGATGTAGCAGG - Intergenic
1163323523 19:16588370-16588392 CCAGCTTTTCAGGAATCAACAGG + Intronic
930528582 2:52562831-52562853 CTAGAATTTCAAGAAGCAGCAGG - Intergenic
935394776 2:102595990-102596012 ATAGATTTTCAGGGATGAGCTGG - Intergenic
936742118 2:115524689-115524711 TTATAGTTTCAGGATTAAGCTGG - Intronic
937756576 2:125546390-125546412 CAAGAATTTCAAGATTCAACTGG + Intergenic
941178402 2:162228939-162228961 CTAGATATTCAGGATTGTGTAGG - Intronic
941374697 2:164713127-164713149 CTAGATTTTCAGGAGTGTGGAGG - Intronic
942694489 2:178625012-178625034 CTAGATTTTCAAAAGCCAGCTGG - Intronic
943098862 2:183462447-183462469 CTAGAATTTCAAGACTCAGGGGG + Intergenic
944913247 2:204330830-204330852 CTATATTTTGAGGCTTCAGCAGG - Intergenic
947034359 2:225835225-225835247 CTAGATGTTAATGATTCTGCAGG - Intergenic
947053353 2:226072257-226072279 ATAGATTTTCAGTTTTAAGCAGG + Intergenic
1171582578 20:26476599-26476621 CTAGATTTTTAGGATTTCGTTGG + Intergenic
1171585521 20:26517727-26517749 CTAGATTTTTAGGATTTCGTTGG + Intergenic
1171586041 20:26525202-26525224 CTAGATTTTTAGGATTTCGTTGG + Intergenic
1171589055 20:26568710-26568732 CTAGATTTTTAGGATTTCGTTGG + Intergenic
1171590222 20:26585373-26585395 CTAGATTTTTAGGATTTCGTTGG + Intergenic
1171590380 20:26587647-26587669 CTAGATTTTTAGGATTTCGTTGG + Intergenic
1173384672 20:42576328-42576350 CCAGATGTTCAGGATTTAACAGG - Intronic
1174422504 20:50408801-50408823 CAAGATTTTTAGGATTCCCCAGG + Intergenic
1174665045 20:52250158-52250180 ATTGATTTTCAGTGTTCAGCTGG - Intergenic
1175714854 20:61248398-61248420 CTAGAGGGTCAGGATTCTGCTGG + Intergenic
1176882835 21:14217415-14217437 CTAAATTTTCAGGATTGAATGGG + Intronic
1176895454 21:14373328-14373350 CTATATTTTCTGGATTCTGGAGG - Exonic
1177229961 21:18306676-18306698 CTAGATTTTAATGATTTAGCAGG + Intronic
1178056763 21:28807802-28807824 TTAGTTTTACAGGATTTAGCTGG - Intergenic
1179775346 21:43658621-43658643 CTATATTTTGCGGACTCAGCGGG - Intronic
1179778979 21:43687595-43687617 CTGGATTTTCAGGCTGCAGGTGG - Exonic
1180890109 22:19281619-19281641 CTGGATTTTCCGGCTTTAGCAGG + Intronic
1181450153 22:23014374-23014396 CCACAGTTCCAGGATTCAGCGGG + Intergenic
1181988748 22:26820649-26820671 ATAGACTTTGAGGATTCAGACGG + Intergenic
1182843951 22:33415549-33415571 CCATCTTTTCAGGATGCAGCTGG + Intronic
1182939808 22:34264730-34264752 TTAGACTTTTAGGATTCATCAGG + Intergenic
952030621 3:29137913-29137935 CTAGATTTTCATCATTCTTCTGG - Intergenic
955543003 3:59998162-59998184 CTAGATTTTCAGGAGTCGATTGG - Intronic
956143491 3:66169171-66169193 CTAGATTTTCATTATTATGCAGG + Intronic
959429340 3:106233348-106233370 CTATATTTTCAGGGCTCAGAGGG + Intergenic
960087949 3:113610965-113610987 CCAGATGATCAGGATTCAGTAGG - Intronic
960935157 3:122894944-122894966 TGGGATTTTCAGGATTCAGATGG + Intergenic
961032679 3:123620216-123620238 CTAGTTTTTCTGCATTGAGCGGG + Exonic
962753139 3:138449393-138449415 CTACATTTTCAGGATGCATGTGG + Intronic
962842967 3:139252184-139252206 TTAGATTTTCAGGCATCAGATGG - Intronic
963377993 3:144494547-144494569 CCACATTTTGAGGATCCAGCAGG + Intergenic
971969081 4:33598682-33598704 CTTGATTCTCAGGAATAAGCAGG - Intergenic
975483580 4:74909417-74909439 CAAGATTTTCAGGATTCAACTGG + Intergenic
975723422 4:77269752-77269774 CTTGATTTGCAGGTTTGAGCGGG + Intronic
980708575 4:136533476-136533498 CTATATTTTCAGTATTGAACTGG + Intergenic
982370777 4:154630604-154630626 CTAGGTTTTGAGGATTCAAAGGG + Intronic
982682328 4:158445999-158446021 CTAGATTTTCAGTTTTGAACTGG + Intronic
984905247 4:184620322-184620344 CTAGATACTCAGGATGCGGCTGG + Intergenic
993236364 5:85315152-85315174 TTAGACTTTCAGAATTCAGTAGG - Intergenic
994100327 5:95884268-95884290 CTGGAGGTTAAGGATTCAGCTGG + Intergenic
995062901 5:107830892-107830914 GGAGATTTTCATGGTTCAGCAGG + Intergenic
995454123 5:112333992-112334014 CTAGTTTTTCAGGTTTCACTGGG - Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
1000579974 5:163024487-163024509 CTAGATTTCAAGTGTTCAGCTGG + Intergenic
1001684746 5:173585002-173585024 TTGGATTTGCAGGACTCAGCTGG - Intergenic
1001919010 5:175586040-175586062 CTAGATATTCAGGTTGCAGTGGG + Intergenic
1004215202 6:13696379-13696401 TTAGAATTTTAGGTTTCAGCTGG - Intronic
1004328799 6:14702078-14702100 CTTGTTTTTCAGCACTCAGCAGG - Intergenic
1008643292 6:53486729-53486751 CTAGAGTTTCAGGATGGGGCAGG - Intergenic
1011367318 6:86597448-86597470 CTAAATTTTGAGGAGTCAGTGGG + Intergenic
1012580464 6:100863105-100863127 CTAGATTTTCCAAATTTAGCAGG - Intronic
1012857843 6:104524186-104524208 CTAAATTTAAAGGTTTCAGCAGG + Intergenic
1017359148 6:153545680-153545702 CTAGATTTTCAGGTTAGTGCTGG - Intergenic
1018040492 6:159917375-159917397 CTATATTCTCTGGATTCAGAGGG + Intergenic
1019652923 7:2170317-2170339 GTAATTTTTCAGGATTCTGCAGG - Intronic
1021641753 7:22744420-22744442 CTAGTTTTTCAGGTTTCTTCGGG + Intergenic
1025248318 7:57334650-57334672 CTAGATTTTTAGGGTTCCCCAGG - Intergenic
1028818288 7:95175383-95175405 CAAGTTTTTCAGGATTAAGTTGG - Intronic
1030282393 7:107790509-107790531 TGACATTTTCAGTATTCAGCAGG + Intronic
1030766153 7:113412055-113412077 CTAGAATTGGAGGATTAAGCTGG - Intergenic
1031439946 7:121781840-121781862 CTAAATTCTCAGGACTCACCAGG + Intergenic
1037839954 8:22237634-22237656 CTAGACTTGGAGGATTCAGGTGG + Intergenic
1037929176 8:22867479-22867501 CTAGATTTTCAGGTTGCGGAAGG + Intronic
1042314016 8:67406545-67406567 CTTGATTTTCATGATTTCGCGGG - Intergenic
1044188180 8:89281556-89281578 CTAGTTTTTCAGGTTTCCTCTGG - Intergenic
1048355635 8:133651893-133651915 CTAGAGTTTCAGAATGAAGCAGG - Intergenic
1048774203 8:137927202-137927224 CTACATTTTCAGTATACAGATGG - Intergenic
1049392591 8:142379850-142379872 CTAGATCTACAGCCTTCAGCAGG + Intronic
1049987693 9:967529-967551 CTACTTTTTCAAGATACAGCAGG - Intronic
1050114397 9:2248695-2248717 CAAGATTTTCACCATTCTGCTGG + Intergenic
1051021398 9:12547876-12547898 CTAGTGTTTCAGGAGTCCGCAGG + Intergenic
1055020412 9:71663502-71663524 CTTGATTTACAGGAATCAACAGG - Intergenic
1057929607 9:99182191-99182213 CTGAATTTTCTGAATTCAGCTGG - Intergenic
1057986370 9:99719113-99719135 CTAGATTTTCAGTAATGAACAGG + Intergenic
1058730647 9:107846783-107846805 CTAGATTTCTAGGTTTCAGCTGG - Intergenic
1059471811 9:114510771-114510793 CTACATTCTGGGGATTCAGCAGG + Intergenic
1059806858 9:117810720-117810742 CTATATGTTTATGATTCAGCTGG - Intergenic
1189789068 X:44586154-44586176 CTAGACTTTGAGGATGCTGCTGG + Intergenic
1191054467 X:56227963-56227985 CTAAATTTATAGGACTCAGCAGG + Intergenic
1192762456 X:74107459-74107481 CTACATTTACAGTATCCAGCAGG + Intergenic
1197107344 X:122732039-122732061 CTACACTTTCTGGAGTCAGCAGG - Intergenic