ID: 1098061821

View in Genome Browser
Species Human (GRCh38)
Location 12:66571046-66571068
Sequence CACTATCACTTTAGTTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098061820_1098061821 -8 Left 1098061820 12:66571031-66571053 CCAGTCTTCTTTCTGCACTATCA 0: 1
1: 0
2: 0
3: 29
4: 310
Right 1098061821 12:66571046-66571068 CACTATCACTTTAGTTAACATGG 0: 1
1: 0
2: 1
3: 11
4: 116
1098061819_1098061821 -2 Left 1098061819 12:66571025-66571047 CCACATCCAGTCTTCTTTCTGCA 0: 1
1: 0
2: 3
3: 37
4: 448
Right 1098061821 12:66571046-66571068 CACTATCACTTTAGTTAACATGG 0: 1
1: 0
2: 1
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098061821 Original CRISPR CACTATCACTTTAGTTAACA TGG Intronic
904402636 1:30266947-30266969 CAATCTCACTTCAGTTCACACGG + Intergenic
908572245 1:65421691-65421713 TAATATCAGTTTAGTAAACATGG + Intronic
911316866 1:96366327-96366349 TCCTATCACTTTAGTTAACTGGG + Intergenic
911321869 1:96424131-96424153 CACTTTCAGTTTAATTCACAGGG + Intergenic
911871462 1:103106425-103106447 CAGTACCACTGTAGTTAAGAGGG + Intronic
916483764 1:165238517-165238539 CACTATCACTATACTTCTCATGG - Intronic
919085898 1:192919678-192919700 CAACATCACTTTAGTGAACATGG - Intergenic
919433376 1:197525428-197525450 CAATTTCACTTTTGTTGACAGGG + Intronic
921085419 1:211786833-211786855 CACTATTACTTTTATTTACAAGG - Intronic
921546595 1:216481697-216481719 CACTCTCATTTGAGTTAACTTGG + Intergenic
922147744 1:222965035-222965057 AACTATGATTTGAGTTAACATGG - Intronic
924038953 1:239964494-239964516 CACAGGCACATTAGTTAACACGG - Intergenic
1081201640 11:40223319-40223341 CACTAGAACTTAAGTGAACATGG + Intronic
1084047831 11:66580378-66580400 CAATATCACATTACTTAAGATGG + Intergenic
1086289954 11:85297276-85297298 CACTATCACTTTAGAACAAAAGG - Intronic
1086823204 11:91461724-91461746 CACTGCCACTTCAGTTATCATGG + Intergenic
1090507595 11:127335456-127335478 CACAATCATTTTAGTTAGCTTGG + Intergenic
1092703716 12:11261504-11261526 CACTATCATTACAGTGAACAGGG + Intergenic
1095549684 12:43419608-43419630 CACTTTCACTTTCTTTAACATGG + Intronic
1096929431 12:55190023-55190045 CTCTAGAACTTTAGTTAAAATGG + Intergenic
1098061821 12:66571046-66571068 CACTATCACTTTAGTTAACATGG + Intronic
1098088953 12:66880334-66880356 TCCTGTCACTTTAATTAACATGG - Intergenic
1100368308 12:93942051-93942073 CACTGGGACTTTGGTTAACAGGG + Intergenic
1101048185 12:100832815-100832837 CACTTTCTCTTTATTTAAGATGG - Intronic
1101416345 12:104511743-104511765 CACTATCACTTTCCTTATTAGGG + Intronic
1104738768 12:131157363-131157385 CCCTATCACTTGAATGAACATGG - Intergenic
1106971585 13:35147322-35147344 CACTCTCATTTGAGTTAACTTGG - Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1108362726 13:49682397-49682419 CATCATCACTTTAGTATACAGGG + Intronic
1108817069 13:54305230-54305252 GACTAGCACTTCAGTTTACATGG + Intergenic
1108823140 13:54378343-54378365 CACTGTCACTTTAATTAAACTGG + Intergenic
1109215056 13:59580225-59580247 ATCCATCACCTTAGTTAACATGG + Intergenic
1110588484 13:77223815-77223837 ACCTATCACTTAAGTTCACATGG + Intronic
1110660090 13:78050364-78050386 AACCATCACTTTATTTCACAGGG + Intergenic
1113053939 13:106246795-106246817 CAGTACCACTTTATTTTACAAGG + Intergenic
1119532749 14:75374333-75374355 CACTATCTCTGTAGATAATAGGG - Intergenic
1123870190 15:24563663-24563685 CACTAACACTTTAGTATACTAGG - Intergenic
1124920381 15:34020503-34020525 CATTAACCCTTTAGTTAACAAGG - Intronic
1137682468 16:50362089-50362111 CACTATATGTTCAGTTAACATGG - Intronic
1144648285 17:16990270-16990292 CAATCTCACTTTGGTCAACATGG + Intergenic
1153756272 18:8286549-8286571 TACTCTCACTTTAGATCACATGG - Intronic
1158838661 18:61359519-61359541 CACTCTCACTTCACTGAACAAGG + Intronic
1159573581 18:70147882-70147904 CACTAGCATGTTAATTAACAGGG + Intronic
1162837495 19:13330496-13330518 CACTATCACTTTGCTTAAAGGGG + Intronic
1164083224 19:21878646-21878668 CACCATCACTTTAGTGAGCAGGG - Intergenic
1167509059 19:49886746-49886768 CACTTTCATTTGAGTTAACTTGG + Intronic
924987482 2:285473-285495 CCCTATCACTGTAGCTAATAAGG + Intronic
928552703 2:32388951-32388973 CACTGTCACCTTTGTTAGCAAGG - Intronic
931759516 2:65404297-65404319 GACTTTCCCTTTATTTAACATGG - Intronic
940837453 2:158539143-158539165 AAATATCACTTAAGTTAATAAGG - Intronic
942090076 2:172481212-172481234 AACTACTACTTTAGATAACAGGG - Intronic
942565407 2:177261286-177261308 CACTCTCCCTGTATTTAACAAGG + Intronic
1169676734 20:8163184-8163206 CACTATCAAATAAGTTACCATGG + Intronic
1173739116 20:45383960-45383982 CACTATCACTTTTTTTAAATGGG + Intronic
1174264621 20:49322489-49322511 CAATTTAACTTAAGTTAACAAGG + Intergenic
1176231633 20:64036044-64036066 CCCTATCACTTCAATTAACCTGG - Intronic
1177750565 21:25278146-25278168 CTCTATTACATTAGTTAGCATGG + Intergenic
1178557080 21:33601613-33601635 AACTATCACTTAAGTAAACTGGG + Intronic
950738313 3:15029294-15029316 CACTATCACTCTAGTTACCCTGG - Intronic
951660593 3:25060047-25060069 TTCTATCACTGTATTTAACACGG - Intergenic
952932066 3:38368238-38368260 CACCATCACTGTAGTCAATAGGG - Exonic
953541712 3:43825146-43825168 CAGTAACACTTTAATTAATATGG - Intergenic
953695855 3:45158511-45158533 AACTATGAGTTTAGTTAAAAAGG - Intergenic
953789388 3:45935616-45935638 TACTGTCACTTTATTTAAAATGG + Intronic
954918243 3:54166629-54166651 CACAATCATCTTAGTTAAAAAGG + Intronic
957588880 3:82169784-82169806 CACAATGACTATAGTTAATAAGG + Intergenic
960193816 3:114740712-114740734 CTCTATCACTGGAGTTTACATGG + Intronic
960345665 3:116528805-116528827 CATTCTCATTTTAGTTTACATGG - Intronic
961563239 3:127745957-127745979 CAAAATAACTTTTGTTAACATGG - Intronic
966716595 3:183018950-183018972 CACTTTCGTTTTGGTTAACATGG + Intronic
967132291 3:186483089-186483111 TACTATCACTTTGGTTAAGCTGG + Intergenic
969133292 4:5008732-5008754 GACTATCACTTTAGTTATAGAGG + Intergenic
969722702 4:8901348-8901370 CACTGTCAATGTAGTTAAGATGG - Intergenic
972129569 4:35814591-35814613 TACTATCTTTTTAGTTTACAGGG - Intergenic
978826289 4:113027889-113027911 CACTATCAGGTTATGTAACATGG + Intronic
979558843 4:122079590-122079612 CATTATCACATCAGATAACAAGG - Intergenic
983488933 4:168365396-168365418 CACTAACACATTTGATAACATGG + Intronic
987945735 5:24606114-24606136 AACTACCACTGTAGTCAACATGG - Intronic
988184504 5:27842706-27842728 CCCTATCACTTTAGTTCACTTGG + Intergenic
988258116 5:28847925-28847947 CTCTAACAATTTAGTTCACAGGG + Intergenic
990421816 5:55643033-55643055 CATTATGACTTTTGTTTACAAGG + Intronic
991479645 5:67063602-67063624 TGCTACCACTTTTGTTAACATGG - Intronic
992117082 5:73549318-73549340 CACTATCAATTCAGTCAACTTGG + Intergenic
993209782 5:84933587-84933609 CAATATCATCTTGGTTAACATGG - Intergenic
994335831 5:98564905-98564927 CACTTTGACTTTAGTTTAAATGG - Intergenic
996079169 5:119236231-119236253 TTCTTACACTTTAGTTAACATGG - Intronic
998808676 5:145943612-145943634 CACTATCACTTAAGTGATCAGGG + Intronic
1000310399 5:160037973-160037995 CACAGTCACTTTAGGTGACAAGG + Intronic
1001660258 5:173385880-173385902 CACTCTCCCTTTATTTTACATGG + Intergenic
1008623662 6:53297039-53297061 CACTTTCAAAGTAGTTAACAGGG + Intronic
1010018055 6:71127449-71127471 CACTATGACATTCGTTAACAAGG + Intergenic
1011206394 6:84903922-84903944 CACTCTCCCTTAAGGTAACATGG - Intergenic
1014282743 6:119459836-119459858 CACTATCACTTTCCTTATCTGGG - Intergenic
1015083011 6:129251478-129251500 AGCTATTATTTTAGTTAACAGGG + Intronic
1015258160 6:131203396-131203418 CACTATCAATCTAAATAACATGG - Intronic
1018274606 6:162117426-162117448 CACTTTTACTATAGTTCACATGG - Intronic
1020824388 7:13009222-13009244 AGCTATCACTATAGTTAATAAGG + Intergenic
1020936292 7:14468497-14468519 AACTATCAATTTAGTTTAAAGGG - Intronic
1023027878 7:36067498-36067520 CACTGTCTCTTGAGTTATCATGG + Intergenic
1024567045 7:50689732-50689754 CAATATCACTTTTGTTAACATGG - Intronic
1027482635 7:78718021-78718043 CACTATTTCTTTATTTAACAAGG + Intronic
1027905538 7:84175983-84176005 TCCTATCACTTTATTTGACATGG + Intronic
1028417825 7:90597667-90597689 CATTAACACTTTCGTTAACATGG - Intronic
1031641503 7:124170370-124170392 CACTCTCAGTTTAGTCAACTAGG - Intergenic
1031747017 7:125512250-125512272 CAACTTCACTTTTGTTAACATGG + Intergenic
1033011863 7:137631747-137631769 CATTTTTACTTTACTTAACATGG - Intronic
1038890976 8:31722928-31722950 CACTATGACTTTATATATCATGG - Intronic
1040722412 8:50341772-50341794 CAATATCAGTTAAGTTTACAAGG - Intronic
1041878257 8:62715316-62715338 CATTATCACATTAGTCAACCTGG - Intronic
1042003277 8:64151060-64151082 TAATATCACTTGGGTTAACATGG - Intergenic
1044093825 8:88037041-88037063 CACTTTGAGTTTAGTTAATATGG + Exonic
1045027411 8:98101072-98101094 CACTAACAAATTAATTAACATGG + Intergenic
1047153358 8:122289797-122289819 CACTATAATTTTATGTAACAAGG - Intergenic
1051762061 9:20478602-20478624 CATGATCACTATAGTTAAGATGG + Intronic
1052581208 9:30356901-30356923 CAGTATCACATTATTTATCAAGG + Intergenic
1057410972 9:94816362-94816384 CACTCTCACCTGAGTTAACTTGG - Intronic
1057751877 9:97798908-97798930 TTCTTTCATTTTAGTTAACATGG - Intergenic
1058046116 9:100358687-100358709 ATCTATTACTTTACTTAACAAGG - Intergenic
1059915793 9:119098647-119098669 CACAATCAAGTTAATTAACATGG - Intergenic
1062446267 9:136596616-136596638 CACAATCACTTTTGTTACCCAGG - Intergenic
1186053942 X:5628840-5628862 TATTACCACGTTAGTTAACAAGG - Intergenic
1187590920 X:20716349-20716371 CACAATCACTTCTGTTAGCATGG + Intergenic
1187666899 X:21623274-21623296 CATTATTACTTTAGGTAAAAGGG - Intronic
1192823131 X:74665644-74665666 CTCTAACACATTAGTAAACATGG + Intergenic
1193574285 X:83180388-83180410 CAATATAAGTTTATTTAACATGG + Intergenic
1196064887 X:111453274-111453296 GACTTTCATTTTAGATAACATGG + Intergenic
1197067085 X:122246201-122246223 AACTATCACTTTGATAAACATGG - Intergenic
1197790353 X:130248404-130248426 CACTGACACTTTAGTTGGCAGGG + Intronic
1199696101 X:150343596-150343618 CAATATCACTTGATTTCACAGGG - Intergenic