ID: 1098071824

View in Genome Browser
Species Human (GRCh38)
Location 12:66684143-66684165
Sequence TTAGCCACTTTGTATTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098071822_1098071824 6 Left 1098071822 12:66684114-66684136 CCTAGAACAGAGAGCAGTAACAG 0: 1
1: 0
2: 1
3: 29
4: 307
Right 1098071824 12:66684143-66684165 TTAGCCACTTTGTATTTGGTAGG 0: 1
1: 0
2: 2
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098071824 Original CRISPR TTAGCCACTTTGTATTTGGT AGG Intronic
902802633 1:18839840-18839862 TTGGCCTCGTTGTAGTTGGTGGG + Exonic
903285932 1:22276774-22276796 TTTGCCACTTTGTCTATGGAAGG + Intergenic
905235820 1:36547286-36547308 TTATCCACTTTATATATTGTTGG + Intergenic
908679162 1:66640464-66640486 TTAGCCTCTATGTATATGTTAGG - Intronic
911576335 1:99582998-99583020 TTATCCAATTTGTCATTGGTGGG - Intergenic
912416810 1:109514346-109514368 TTAGCAACTTTGTATTTTTTTGG + Intergenic
913177724 1:116290359-116290381 ATAGCCCCTTTGTGTTAGGTTGG + Intergenic
913484949 1:119325855-119325877 TTTGCCATCTTGGATTTGGTGGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
922229442 1:223672964-223672986 TTATCCAATTTGTAATTGATGGG - Intergenic
923383263 1:233442486-233442508 TCACCCACTTTGGTTTTGGTGGG - Intergenic
924838351 1:247678530-247678552 TAGGCCACTTTCTATTAGGTAGG + Intergenic
1063434114 10:6016985-6017007 TGACCCACTTTGAATTTGGGGGG - Intronic
1063650361 10:7930034-7930056 TTTGCTATTTTGTTTTTGGTAGG - Intronic
1066394102 10:35002472-35002494 TGAGCCACTTTGCATTTCTTGGG - Intergenic
1069120691 10:64566379-64566401 TTAGCTTCTTTGCATTGGGTTGG + Intergenic
1069308161 10:66998426-66998448 TTAGTCCCTTTGTATTTATTGGG - Intronic
1070223841 10:74479373-74479395 TTAGCCACTTTGTTTTTTGTTGG + Intronic
1073784275 10:106871497-106871519 TTATCCAGTCTGTAGTTGGTGGG - Intronic
1074167255 10:110893403-110893425 AAATCCCCTTTGTATTTGGTGGG - Intronic
1075347688 10:121696220-121696242 TAAGCCACTTTGTTTTAGGGTGG + Intergenic
1075894444 10:125982974-125982996 TTTGTCACATTGTCTTTGGTGGG + Intronic
1081531178 11:43960251-43960273 TCAGCCACTTTCTATGGGGTTGG - Intergenic
1082883665 11:58062344-58062366 TGAGCCACTTTTTAGTTGATTGG + Intronic
1083845113 11:65327111-65327133 TTAGCTACTTTGTTTTTTTTGGG - Intergenic
1085729825 11:78987734-78987756 ATAGCCACTTTCTATCTTGTAGG + Intronic
1086420521 11:86633252-86633274 TTAGTCACTTACTATTTGCTAGG + Intronic
1087435494 11:98112281-98112303 TTATCCACTCTGTTATTGGTGGG - Intergenic
1087795261 11:102449875-102449897 TCTGCCACTTTGTATCTGGGCGG - Intronic
1089219736 11:116860562-116860584 GTAGCTGCTTTTTATTTGGTAGG + Intronic
1092841428 12:12545881-12545903 TTACCGGCTTTGAATTTGGTGGG - Intronic
1093179426 12:15950408-15950430 ATAGCCATTTTGGTTTTGGTGGG + Intronic
1093626580 12:21355820-21355842 TTAACCATTTTATATATGGTTGG - Intronic
1093709733 12:22316776-22316798 TTAGCCACTTTCTTCTTGGGTGG - Intronic
1097749091 12:63331825-63331847 TTAGCTTCTTTGCATTGGGTTGG - Intergenic
1098071824 12:66684143-66684165 TTAGCCACTTTGTATTTGGTAGG + Intronic
1098696534 12:73564494-73564516 TTATCCATTTTTTATTTGATGGG - Intergenic
1100154423 12:91781089-91781111 CTAGCCACTTTGTAGTTTGATGG + Intergenic
1101179930 12:102204921-102204943 TGAGACAGTTTGAATTTGGTTGG + Intergenic
1104054841 12:125221686-125221708 TTAATCACTTTGTTTTAGGTAGG - Intronic
1104193539 12:126507757-126507779 TCAGACTCTTGGTATTTGGTAGG + Intergenic
1104303020 12:127582818-127582840 TGAAACAATTTGTATTTGGTAGG + Intergenic
1105301387 13:19138425-19138447 TAAACCACTTTTGATTTGGTTGG + Intergenic
1106375218 13:29180037-29180059 TTAACTACTTTGTCTTTGGCTGG + Intronic
1108563910 13:51675455-51675477 CTAGCCACTCTGTATAGGGTAGG - Intronic
1108729792 13:53223099-53223121 TTAGCCACTCTGTATTTCAAAGG + Intergenic
1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG + Intergenic
1111721753 13:91955532-91955554 TTAGCCACCTGGGATTTGTTGGG + Intronic
1114505516 14:23209230-23209252 GTAGCCATTTTGGTTTTGGTGGG + Intronic
1119575508 14:75717734-75717756 GTAGGCACTTGGTATTTGTTAGG + Intronic
1119787751 14:77325760-77325782 ATAGTCACTTGGTATTTGCTGGG + Intronic
1123956890 15:25345861-25345883 TTAGTTTCTTTGTATTTGATGGG - Intronic
1124447822 15:29754133-29754155 TTATCCACTCTGTCATTGGTGGG - Intronic
1124874131 15:33574939-33574961 TTTTCCACTTTGCATTTGCTTGG - Intronic
1125357312 15:38830065-38830087 TTAAGCACTTTGTATTTGCAAGG + Intergenic
1125880187 15:43186487-43186509 TTAAGCACTTTTTATTTGCTGGG + Intronic
1131907301 15:97157024-97157046 TTAGCAACTTTGTGACTGGTGGG + Intergenic
1132112353 15:99111096-99111118 TTTTCCTCTTTGTATTTTGTGGG + Intronic
1135034939 16:19069090-19069112 TAAGCCACTTAATATTTTGTAGG + Intronic
1135279758 16:21144239-21144261 TTTGCCACATTCTATTTGTTAGG - Intronic
1139816380 16:69677413-69677435 TGAGCAACTTTCTTTTTGGTTGG - Intronic
1151142440 17:72006809-72006831 TTATCCAGTCTGTCTTTGGTGGG - Intergenic
1151170325 17:72240445-72240467 TTTGCCACTTTCTATTTGTTAGG + Intergenic
1151280074 17:73066911-73066933 TTAGTCTCTTTGTATTAGCTAGG - Intronic
1154033391 18:10773765-10773787 TTTGTCACTTTCTTTTTGGTTGG + Intronic
1156060669 18:33071681-33071703 TTAGCCACATTATATTTAGGTGG + Intronic
1158667195 18:59443201-59443223 ACAGCCGCTTTGTATTGGGTTGG + Intronic
1159437566 18:68438615-68438637 TTTGCCATCTTGGATTTGGTGGG + Intergenic
1163074236 19:14874785-14874807 TTAGCCACTCATTGTTTGGTGGG + Intergenic
1164748025 19:30630264-30630286 TCAGGCACTTTCTATTAGGTTGG + Intronic
1164863309 19:31581082-31581104 CTTGCCTCTTTGTATCTGGTGGG - Intergenic
1167990611 19:53357811-53357833 CTAGCCATTTTGATTTTGGTAGG - Intergenic
926086693 2:10024639-10024661 TTTGCCAATTTGTTTTTGTTGGG - Intergenic
926482409 2:13415691-13415713 TTAGGCTCTTTATTTTTGGTTGG - Intergenic
929948624 2:46389325-46389347 TTAAACACTGTGTATTAGGTGGG - Intergenic
931560594 2:63556482-63556504 TTAGCCTCTTTGCATTGGGTTGG + Intronic
932078121 2:68685607-68685629 TTTGCTACTTTTTATTGGGTTGG - Intronic
933009298 2:77037709-77037731 TTAGACACATTTTATTTGTTTGG + Intronic
933707031 2:85299025-85299047 TTCCCTACTTTGTATTAGGTTGG + Intronic
936928475 2:117762157-117762179 TCAGGCACTTGGTATTTGATCGG - Intergenic
937812543 2:126215019-126215041 TTCTCCACTTTTTATTTTGTGGG + Intergenic
939579584 2:143931943-143931965 TTACCATCTTTGTATTGGGTGGG - Intergenic
940779873 2:157921660-157921682 TAAGCCACTATTTATTTGTTGGG - Intronic
941161114 2:162035434-162035456 TGAACCACTTTGCATTTGCTGGG + Intronic
941593500 2:167448009-167448031 TTATCCACTTTTTGATTGGTGGG + Intergenic
942423256 2:175830591-175830613 TTTATCACTTTGTATTAGGTTGG - Intergenic
945498442 2:210538095-210538117 TTAGCCACTTTGTTTGTGGCAGG + Intronic
947360015 2:229337170-229337192 TTAGCCTCATTGTATTAGGTTGG - Intergenic
947456582 2:230259827-230259849 TTATCCACTTGTTAATTGGTGGG + Intronic
1169838187 20:9904191-9904213 GCAGCCACTTTGTGATTGGTAGG - Intergenic
1173765561 20:45606121-45606143 TCAGCCACTCTGTTTTTGGTTGG + Intergenic
1175207830 20:57325496-57325518 TTAGCCAGGTTGGATTTGGGAGG + Intergenic
1175630690 20:60533912-60533934 ATAGACAATTTGTATTGGGTGGG + Intergenic
1177229139 21:18296389-18296411 TTAGCCACATTATATTGGGTTGG - Intronic
1177436241 21:21057057-21057079 TTAGCCTCTTTATATTTTGGGGG - Intronic
1177878801 21:26668494-26668516 TTAGCTTCTTTGCATTTGGTTGG + Intergenic
1178511151 21:33206172-33206194 TATGCCATTTTGTATTGGGTTGG - Intergenic
1179932115 21:44577706-44577728 TTGTCCACTTTCTATTTGGTAGG - Intronic
1180393571 22:12307918-12307940 TTAGCCACTTTGTTAACGGTGGG - Intergenic
1180406175 22:12556844-12556866 TTAGCCACTTTGTTAACGGTGGG + Intergenic
1181279811 22:21711287-21711309 TTAACCACTTTACATTTAGTTGG + Intronic
1182842674 22:33404461-33404483 AGAGCCACTTTCTATTAGGTAGG - Intronic
1183757684 22:39785289-39785311 TCAGCCACTCTGTATTTGAAAGG + Intronic
949189093 3:1230059-1230081 TTAGGAACTTTCCATTTGGTTGG - Intronic
955007473 3:54982870-54982892 ATCGCCACTTTGGTTTTGGTGGG + Intronic
955490550 3:59477745-59477767 TTAGCCATTTTGTTTGTGGGAGG + Intergenic
956789101 3:72667013-72667035 TTAGCTATTTTGGCTTTGGTTGG + Intergenic
958105109 3:89062078-89062100 TTAGCCACTTTGCATTTCTTAGG - Intergenic
963234892 3:142946939-142946961 TTTGCCACCTTGGTTTTGGTGGG + Intergenic
964767874 3:160196333-160196355 TTACCCACTTTCTATTTGTCAGG - Intergenic
965201008 3:165657286-165657308 GTAGCCACTTTGGATTTCCTGGG + Intergenic
965263463 3:166511703-166511725 TTAGCTTATTTGTATTGGGTTGG - Intergenic
966541050 3:181090096-181090118 TTAGCCAATTTTTTTATGGTAGG + Intergenic
966587821 3:181647207-181647229 TTAGCCATTTTCTTCTTGGTGGG - Intergenic
966661274 3:182417692-182417714 TCAGCCTCTTTGGATTTGGAAGG + Intergenic
968854342 4:3107925-3107947 TTAGCCTCTTCCTTTTTGGTAGG + Intronic
968973648 4:3810054-3810076 TCTGCCACTTTCTACTTGGTGGG + Intergenic
970048340 4:11882048-11882070 TTTGTTAATTTGTATTTGGTTGG - Intergenic
971460596 4:26891694-26891716 TAGGCCTCTTTGTATTTGGAAGG - Intronic
973568097 4:52208435-52208457 TTAGCCTCCTTGCATTGGGTTGG - Intergenic
975135743 4:70872382-70872404 TTGGCTAGTTTGTATCTGGTGGG - Intergenic
976115935 4:81726393-81726415 TCAGCCACTCTGTCTTTGGATGG - Intronic
977662718 4:99609517-99609539 GGAGCCACTTTGCATTTGGGAGG - Intronic
979520204 4:121657166-121657188 TAAGCCACTGTGTTTGTGGTAGG + Intergenic
980381669 4:132028513-132028535 TTAGTAATTTTGTTTTTGGTGGG - Intergenic
980684224 4:136204152-136204174 ATAGCCAGTTAGCATTTGGTAGG - Intergenic
981030060 4:140115865-140115887 TCAGTTTCTTTGTATTTGGTGGG - Intronic
982590986 4:157310004-157310026 TAAGCCACTTTCCATTTGCTGGG - Intronic
982709386 4:158744996-158745018 TTAAACACATTGTATTTGGCTGG - Intergenic
982848285 4:160277785-160277807 TTAGCTTCTTTGCATTGGGTTGG - Intergenic
983434243 4:167691535-167691557 TTATCCACTCTGTCATTGGTGGG + Intergenic
986354176 5:6907715-6907737 TGAGTCACTCTGTGTTTGGTTGG + Intergenic
989388358 5:40875437-40875459 TTAAACACATTGCATTTGGTTGG + Intergenic
990479287 5:56192619-56192641 TCAGCTACTTAGTATTTTGTTGG + Intronic
990746746 5:58966331-58966353 TTTGCCACTATACATTTGGTCGG + Intergenic
992459882 5:76951102-76951124 TTATCCACCTAGAATTTGGTGGG + Intergenic
992637232 5:78736504-78736526 ATAGCCTCTTTCTATTTGGATGG + Intronic
994362297 5:98866087-98866109 TTACCTACTCTGTATTGGGTGGG - Intronic
996699401 5:126435261-126435283 GTAGCCAATTTGTGTTTTGTGGG + Intronic
998057143 5:139087884-139087906 TTAGCCACTTGGGATGTGGAGGG - Intronic
999285961 5:150394452-150394474 ATAGTCACATTGTATTTGGAGGG + Intronic
999311406 5:150554240-150554262 TTAGCTTCTTAGTATTTGGGAGG - Exonic
999463715 5:151780392-151780414 TTGGCTACTTTTTATTTTGTTGG + Intronic
999538977 5:152550988-152551010 TTAGCCACTAGATTTTTGGTTGG - Intergenic
1000510184 5:162171698-162171720 TTATCCACTCTGTATTTGATAGG - Intergenic
1001055021 5:168442062-168442084 TTAGCCAAGTGGTATTAGGTAGG - Intronic
1002895048 6:1373879-1373901 CAAGCCACTTTGGATTTGGGAGG + Intergenic
1003896829 6:10615873-10615895 ATCGCCACTTTGGTTTTGGTGGG + Intronic
1005301990 6:24480174-24480196 TTAGCCTCTCTGTGTTTGGTAGG - Intronic
1006240988 6:32678989-32679011 TTAGCTTCTTTGCATTGGGTTGG + Intergenic
1006252403 6:32798848-32798870 TTAGACATTTTGTATTTGTAGGG + Intergenic
1008073722 6:47123799-47123821 TTAGCCATTTTTTAATTGGGTGG + Intergenic
1009692343 6:67052049-67052071 TTGGCCATTTTTTATTTGGATGG + Intergenic
1011106492 6:83787382-83787404 TTTGTTACTCTGTATTTGGTTGG - Intergenic
1011291987 6:85787005-85787027 TTAGCTTCCTTGTATTGGGTTGG + Intergenic
1013112510 6:107075445-107075467 TAAGGCACTTTGTATTTGTTAGG - Intronic
1013294750 6:108749123-108749145 TTAGTCACTTTGTATTTGAAAGG + Intergenic
1013789157 6:113816187-113816209 TTAGCCACATTGTATTAGGTTGG - Intergenic
1016552452 6:145296815-145296837 TGAGCCTCTTTATAGTTGGTTGG + Intergenic
1016623868 6:146143373-146143395 TTAGCCACCTTATGCTTGGTGGG - Intronic
1017552439 6:155523310-155523332 GTAGACACTTTGTAATAGGTTGG - Intergenic
1017875640 6:158522018-158522040 TTTGGCACTTTGTAATTGCTGGG - Intergenic
1019007282 6:168809571-168809593 GTTGCCATTTTGGATTTGGTGGG + Intergenic
1019823007 7:3260025-3260047 GTGGCCACTTTGGTTTTGGTGGG - Intergenic
1020689981 7:11342122-11342144 TTTGCCAATTTGTTTTTGTTGGG + Intergenic
1020943095 7:14564715-14564737 TTAGCAGCTTTCTATTTAGTCGG + Intronic
1024665113 7:51538407-51538429 TTATCCACTTTTTGTTTGATGGG + Intergenic
1024888715 7:54177097-54177119 TAAATCACTTTGAATTTGGTAGG - Intergenic
1027751362 7:82150635-82150657 ATTGCCAGCTTGTATTTGGTAGG - Intronic
1027826374 7:83121562-83121584 TCAGCCACTCTGTCTTTGATTGG - Intronic
1027999746 7:85478789-85478811 GTTGCCACTTTGGATTTGGTGGG - Intergenic
1028580162 7:92401096-92401118 TTATCCAATTTGTATTTCCTTGG + Exonic
1030469970 7:109951609-109951631 ATGGCCATTTTGTTTTTGGTGGG - Intergenic
1032227976 7:130049140-130049162 TTTGCCACTTTATATTAGGAAGG - Exonic
1032643004 7:133790556-133790578 TCACCCAATTTGTATTTTGTGGG + Intronic
1035595694 8:855623-855645 GAAGCCAGGTTGTATTTGGTTGG + Intergenic
1037630107 8:20648004-20648026 TTAGCCACTTAATATTTGTGTGG + Intergenic
1038263798 8:26020851-26020873 TTAGCCACTCTACATTTGCTTGG + Intronic
1038397747 8:27259537-27259559 TTATCCACTTGTTAATTGGTGGG + Intergenic
1038413077 8:27373411-27373433 TTAGCTACTTTCTAGTTGGAGGG - Intronic
1040399593 8:47034993-47035015 TTAGCCAAATTCTATTTTGTGGG + Intergenic
1042167620 8:65960864-65960886 TTCTCCACTTTGTTCTTGGTTGG - Intergenic
1042596380 8:70452302-70452324 TTGGCCACTTTTTATTTCTTTGG - Intergenic
1043024086 8:75044831-75044853 TTTGCCACTTTAGATTTGGCTGG - Intergenic
1043561477 8:81498805-81498827 GTAGGCACTTTGTATTCAGTAGG - Intergenic
1045225671 8:100243044-100243066 TCAGCCTCTTTGTGATTGGTCGG + Intronic
1045730019 8:105226978-105227000 CTGGCCACTTGGTATTTGTTTGG - Intronic
1048225068 8:132577259-132577281 TTAGCATCTTTGTATTCTGTTGG - Intronic
1048443592 8:134477532-134477554 TTGTCCACTGTGTATTTGGGAGG - Intergenic
1049316183 8:141969649-141969671 TTGGCCACATTGCATTTGGGGGG - Intergenic
1053039272 9:34856191-34856213 TTAGCTTCTTTGTATTGGGTTGG + Intergenic
1056046809 9:82726832-82726854 ATTGCCACTTTGGTTTTGGTGGG + Intergenic
1056172526 9:84000433-84000455 TTAGTCACTTAGTAGCTGGTTGG + Intronic
1056381243 9:86059080-86059102 TTAGCCACTGTGTATTGGGGGGG - Intronic
1056746578 9:89309198-89309220 TTCGCCATTTTGGTTTTGGTGGG + Intergenic
1056958814 9:91103951-91103973 TTTGCCACTTTCTAGTTGTTTGG - Intergenic
1057934855 9:99228454-99228476 TTGGCCTCTTTGCCTTTGGTGGG + Intronic
1060065840 9:120500396-120500418 TTTGCCACTGTGTTTTTGGAAGG - Intronic
1061697262 9:132385971-132385993 ATAGGCACCTCGTATTTGGTGGG + Intronic
1061751312 9:132779189-132779211 TTAGCCTCTTTGTATTGAGCAGG + Intronic
1185663210 X:1743417-1743439 TTTGCCATCTTGGATTTGGTGGG + Intergenic
1186403430 X:9280501-9280523 TTAGCATTTTTGTATTTGTTTGG - Intergenic
1186824629 X:13327259-13327281 TAAGCTACTGTGTATTTTGTAGG + Intergenic
1188279941 X:28254885-28254907 TTAGCCTCTTTTCTTTTGGTTGG - Intergenic
1189127924 X:38467652-38467674 TTAGCCACATTCTATTTGTTAGG - Intronic
1192951519 X:76022471-76022493 TTAGCTTCTTTGCATTGGGTTGG - Intergenic
1198865601 X:141120218-141120240 TTTGCCCCTTTGGATTTGTTGGG + Intergenic
1198977462 X:142352801-142352823 TAAGACACTTTCTATTTGCTAGG + Intergenic
1200639289 Y:5698731-5698753 TTAGCTTCTTTGCATTGGGTTGG + Intronic