ID: 1098072273

View in Genome Browser
Species Human (GRCh38)
Location 12:66688804-66688826
Sequence AGGGTTGTTTCCTCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098072273_1098072279 2 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072279 12:66688829-66688851 AATAATGTCTAAAGGGGAAAAGG 0: 1
1: 0
2: 2
3: 37
4: 451
1098072273_1098072277 -4 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072277 12:66688823-66688845 CCCTCTAATAATGTCTAAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 109
1098072273_1098072274 -6 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072274 12:66688821-66688843 AACCCTCTAATAATGTCTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1098072273_1098072281 17 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072281 12:66688844-66688866 GGAAAAGGGCTCTATAAAAATGG 0: 1
1: 0
2: 1
3: 19
4: 248
1098072273_1098072282 18 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072282 12:66688845-66688867 GAAAAGGGCTCTATAAAAATGGG 0: 1
1: 0
2: 2
3: 28
4: 255
1098072273_1098072275 -5 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072275 12:66688822-66688844 ACCCTCTAATAATGTCTAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 112
1098072273_1098072280 3 Left 1098072273 12:66688804-66688826 CCTTCAAAGGAGGAAACAACCCT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 1098072280 12:66688830-66688852 ATAATGTCTAAAGGGGAAAAGGG 0: 1
1: 1
2: 0
3: 48
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098072273 Original CRISPR AGGGTTGTTTCCTCCTTTGA AGG (reversed) Intronic
900425967 1:2578848-2578870 AGGCTTGTGTTTTCCTTTGAGGG - Intergenic
903313979 1:22486299-22486321 AGGCTTTTTTGCTCCTTAGATGG + Intronic
903347353 1:22695186-22695208 AGGTTTGCTGCCTCCTTTGCGGG - Intergenic
905832938 1:41088732-41088754 ACGTTTTTTTCCTCCTTAGATGG - Intronic
908151013 1:61303040-61303062 ATGGTTTTTTCCTATTTTGAGGG + Intronic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
913978263 1:143483308-143483330 TTTGTTGTTTCCTTCTTTGAAGG - Intergenic
914072670 1:144308953-144308975 TTTGTTGTTTCCTTCTTTGAAGG - Intergenic
914106484 1:144657403-144657425 TTTGTTGTTTCCTTCTTTGAAGG + Intergenic
915334801 1:155135000-155135022 TGGGATGTTTCCTCCTCTGAGGG + Intergenic
918183092 1:182102330-182102352 AGGGTAGTTTTTTCCTTTGAAGG - Intergenic
918735329 1:188054745-188054767 AGAGTTGTTACCTTCCTTGAAGG - Intergenic
920825860 1:209423821-209423843 GGGGTTTTTTCCTCACTTGAAGG + Intergenic
921218575 1:212957301-212957323 TGGGTTGCTTCCACCTTTGGGGG + Intronic
921557585 1:216616951-216616973 AGGGTTTTTTCTTCTTTTAATGG + Intronic
921603591 1:217133247-217133269 AGGGCTTTTCCCGCCTTTGACGG - Intronic
1064320565 10:14300582-14300604 AGGGTTGGTCCCTACTTTCATGG + Intronic
1064425783 10:15228038-15228060 AGAGTTCTTTTCTCTTTTGATGG - Intronic
1066209866 10:33226137-33226159 AGGTTTGTTTCCTTCTTTTATGG + Exonic
1066278473 10:33891470-33891492 GGGGTTTTTTCCTTTTTTGAAGG + Intergenic
1067201585 10:44176803-44176825 ACGTTTGTTACCTCCTTTGCAGG - Intergenic
1070137798 10:73709965-73709987 AGGGTAGTCTCCTCATGTGAAGG - Intergenic
1070892372 10:79951350-79951372 GGGATTTTTTCCCCCTTTGAAGG + Intronic
1073755419 10:106575909-106575931 AGGGCAATTTCCTCCTGTGACGG - Exonic
1073763758 10:106659193-106659215 AGGTCTGTTTACTCCATTGAGGG - Intronic
1076364729 10:129914565-129914587 GGGGCTGGTTCCTCCTCTGAGGG + Intronic
1077668941 11:4139682-4139704 TGGGTTCTTTCCTCCTTTTAAGG + Intergenic
1077962727 11:7091377-7091399 TGGGTTGTTTCCTAGTTTTAAGG + Intergenic
1080110303 11:28559307-28559329 AGGAATGAATCCTCCTTTGAAGG - Intergenic
1084530851 11:69726976-69726998 AGGGTTCCTTCCCCCTCTGATGG - Intergenic
1085550355 11:77364299-77364321 AGGCTTCTTTCCTCTGTTGATGG - Intronic
1085913587 11:80858087-80858109 AGGGCTGTGTCCTCATGTGATGG + Intergenic
1086502581 11:87468632-87468654 ATTGTTCTTTCCTCCTTTGCTGG + Intergenic
1086845198 11:91740990-91741012 TGGTTTGTTTCTTCCTCTGAGGG + Intergenic
1090096997 11:123752227-123752249 AGGTTTGTAGCCTACTTTGAGGG + Intergenic
1090523244 11:127501286-127501308 AGAGTTGTTTTGTCTTTTGAAGG - Intergenic
1090624140 11:128591008-128591030 TGAGTTGTTTGCTTCTTTGAAGG + Intergenic
1091487637 12:905275-905297 AGGTTTGTTTCATTCTTTAATGG + Intronic
1097066860 12:56326959-56326981 TGGGTTTCTTCCTCCTTTGTAGG - Exonic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097628018 12:62024654-62024676 AAGGTTGTTTACTCTGTTGATGG - Intronic
1098072273 12:66688804-66688826 AGGGTTGTTTCCTCCTTTGAAGG - Intronic
1098151094 12:67547393-67547415 CTGCTTGTTTCCTCCATTGAGGG + Intergenic
1098429745 12:70406770-70406792 AGGGTTGTCTCCTCCTGTCAGGG + Intronic
1098915869 12:76256332-76256354 AGGGTTATTACCTCCTTTCAAGG + Intergenic
1099505992 12:83476667-83476689 AGAATTGTTTTCTTCTTTGAAGG + Intergenic
1101649289 12:106660296-106660318 AGGGATGCTTCCTCCTTGTAGGG + Intronic
1101968993 12:109299643-109299665 AGGGTTGGGTCCCCTTTTGAAGG + Intronic
1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG + Intergenic
1105221084 13:18328151-18328173 TTTGTTGTTTCCTTCTTTGAAGG + Intergenic
1105936198 13:25101841-25101863 AGGGCTGATTCCTCCTATGTGGG - Intergenic
1106147816 13:27066491-27066513 AGGGTTTTTTCTTTCCTTGATGG - Exonic
1106800514 13:33251725-33251747 TGGGTTAGTTCCTCCCTTGATGG + Intronic
1108130005 13:47288584-47288606 AGGGGTGTCTACTCCTTTGGAGG - Intergenic
1109272123 13:60267102-60267124 AGGGGGGCTTACTCCTTTGATGG - Intergenic
1112447341 13:99476237-99476259 AGGGTTTTTTCCTGCTTTTAGGG + Intergenic
1112834288 13:103494822-103494844 CAGGTTGTTTCCTCATGTGAAGG + Intergenic
1113535758 13:111065071-111065093 AGGTCTCTTTCCTGCTTTGAGGG - Intergenic
1114902404 14:27079789-27079811 AGTGTTTTTTCCTCTTATGATGG + Intergenic
1116596166 14:46848535-46848557 AGGATTGTTTAATCCTTTAAAGG - Intronic
1118024904 14:61759212-61759234 AGGGTTGTTATCTACTTTCAAGG - Intergenic
1119590558 14:75883638-75883660 ACTGTTTTTTCCTCCTTGGATGG + Intronic
1121165789 14:91796733-91796755 AGTGTTGATTCCTTCTCTGAGGG - Intronic
1121543265 14:94744456-94744478 ATGCTTGTTTCCTTCTTTAAAGG - Intergenic
1121913654 14:97816193-97816215 AGTATTGGTTCCCCCTTTGATGG + Intergenic
1122206824 14:100151829-100151851 TGGGTTGTTTTCTCCTGTCAAGG - Intronic
1122385579 14:101343561-101343583 AGCTCTGTCTCCTCCTTTGAGGG - Intergenic
1126176158 15:45737749-45737771 AGGCCTGTTTACTCCTGTGAGGG - Intergenic
1126588467 15:50314650-50314672 AGGATTATTCCCTCCTTTGCTGG - Intronic
1127319537 15:57829378-57829400 GGATTTGTTTCCTCCTTAGAAGG - Intergenic
1128908950 15:71494690-71494712 AGGCTTCTGTCCTCCTCTGATGG - Intronic
1131894011 15:97006358-97006380 AGGGCTTTTTCTTGCTTTGATGG - Intergenic
1133436229 16:5782331-5782353 AATGTTGTGTCCTCCTATGATGG + Intergenic
1138298391 16:55906579-55906601 AGGGTGGTTTCTTCCTTTGAGGG + Intronic
1139301741 16:65950757-65950779 AGGCTTGTTCCCTGCTTTCATGG + Intergenic
1148138960 17:45314914-45314936 AGGGTTGTTTTCTTCGTTGTTGG - Intronic
1149215025 17:54344660-54344682 AGTTTTGTTTCCTCCTCTGAAGG - Intergenic
1149347101 17:55750416-55750438 AAGGTTGTTGCCACCCTTGAGGG - Intergenic
1149559186 17:57596020-57596042 AGGGTTGCACCCTCCTTGGATGG - Intronic
1152487441 17:80603440-80603462 GGGGTTGGTGCATCCTTTGAAGG + Intronic
1153509737 18:5838702-5838724 AGGTTTGTTTCTCTCTTTGATGG + Intergenic
1155957588 18:31966818-31966840 ACGGTCATTTCCTCCTTTGGAGG - Intergenic
1158614982 18:58979051-58979073 AGGGGTGTTTCTTCATTTGCTGG - Exonic
1164997206 19:32730385-32730407 AGGGAAGTTTCCTTCTTTCAAGG + Intronic
1165699925 19:37929692-37929714 AAGGCTGTTTCCCCCTCTGAGGG + Intronic
1166268698 19:41700606-41700628 AGGGTTATTTCCTATTTTGTAGG - Intronic
925132075 2:1501364-1501386 AGGCTGGTTTCCTCCTCTGTCGG + Intronic
925704196 2:6668608-6668630 AGGGTGGTTTCCTTCTGTGATGG - Intergenic
927158700 2:20238096-20238118 ACTGTTGTTTCCTCATTGGACGG + Intergenic
928870897 2:35977441-35977463 AGAGTTGTTTTCTTCCTTGAGGG - Intergenic
929039977 2:37734981-37735003 AGCTTTGTTTCTTCCTTAGAAGG + Intronic
929491385 2:42399759-42399781 AGGGTTGCTTTCTCCTTTGCCGG + Intronic
931671141 2:64649020-64649042 AGATTTCTTTCCTTCTTTGAGGG - Intronic
933683305 2:85122591-85122613 AGCGTTGGTTCCTTCTGTGAAGG + Intergenic
934182972 2:89644316-89644338 TTTGTTGTTTCCTTCTTTGAAGG - Intergenic
934293260 2:91718503-91718525 TTTGTTGTTTCCTTCTTTGAAGG - Intergenic
937776524 2:125783360-125783382 AAAGTTGTTTCCTCTTTGGAAGG - Intergenic
941615443 2:167713696-167713718 AGGGTTGATTCCACCTTCAAAGG - Intergenic
941856081 2:170232397-170232419 AGGGCTGTTTCCTCCTGGTAAGG + Intronic
942607060 2:177703754-177703776 AGGAATGTTTTCTCCTTTAAGGG + Intronic
943535669 2:189146819-189146841 ATGCTTGTTTCTTCCTATGAAGG - Intronic
944864585 2:203848013-203848035 ACAGTGGTTTCCTCCTTTGCAGG + Intergenic
945130595 2:206567564-206567586 AGGATTGTTTGCTCTTTGGAAGG - Intronic
948738688 2:240027943-240027965 TGCCTTGTTTCCTCCTTAGAAGG - Intergenic
1169501716 20:6166983-6167005 GGGGTTGTTTACTTCTTTGCTGG + Intergenic
1172275166 20:33675278-33675300 ACGGGTGTTACCTCCTTTCATGG - Intergenic
1175873446 20:62218982-62219004 TGTCTTCTTTCCTCCTTTGAGGG - Intronic
1177920175 21:27143031-27143053 AGCATAGTTTCCTCCTTTCAAGG + Intergenic
1179409454 21:41151141-41151163 AGGAATGTTTCCTCATTTGTGGG + Intergenic
1182351697 22:29703372-29703394 AGGGTTGTTTCCCCCTTTGCTGG - Intergenic
1182921700 22:34086125-34086147 ATGCTTGATTCCTCCTTGGATGG + Intergenic
1184202430 22:42980447-42980469 AGGGTTGTTTGTTTTTTTGAGGG - Intronic
1184689733 22:46112089-46112111 AAGGTTCTTTCCTTCCTTGAGGG - Intronic
1185009524 22:48305435-48305457 AAGGTTGCTGCCTCCTCTGAGGG + Intergenic
1185105040 22:48863900-48863922 GGGGTTGTTTCCTTGTATGAAGG + Intergenic
1203292252 22_KI270736v1_random:6525-6547 AGCTTTGTTTCTTCCTTAGAAGG + Intergenic
950242874 3:11387480-11387502 AGGGCTGTGTTCTCCTTAGATGG + Intronic
951059861 3:18192780-18192802 AGGGTTGTTGCCTATTGTGATGG - Intronic
952833148 3:37582077-37582099 AGGGTTTCTTTCTCCTTGGAGGG - Intronic
955365377 3:58306086-58306108 CGGGTTTTTTCCGCCTTGGACGG - Intergenic
956866560 3:73374698-73374720 CGGGTTGTTTCCACCTTTTCTGG + Intergenic
957560551 3:81815410-81815432 AGAGTTGTTTTCCCATTTGAAGG + Intergenic
958067717 3:88565631-88565653 AGGGTTGTTTTCTCTTTTGGAGG + Intergenic
960683935 3:120278367-120278389 TAGGTTGTTTACTCTTTTGATGG - Intronic
962910880 3:139848517-139848539 AGGGTTGTCACCCCCTTTGGTGG - Intergenic
963003037 3:140700978-140701000 GAGGTTGTTTCCTGCTCTGAAGG - Exonic
964964983 3:162481485-162481507 AGGCTTGTTTCTTTCTTTTAAGG + Intergenic
967180719 3:186901355-186901377 AGGGTGGTTTCCTCCTTAAAGGG + Intergenic
967824928 3:193870112-193870134 AGGGGTGCCTCCTCCTTTGCGGG + Intergenic
969278814 4:6155234-6155256 AATGTTGTTTCCTCCTTAGGAGG - Intronic
970176866 4:13348370-13348392 AGAGTAATTTCCTCCTTTGCTGG + Intergenic
970720721 4:18985746-18985768 AGGGTTGCTTCCTCAAGTGAAGG - Intergenic
972198698 4:36686135-36686157 AGGGTTATTTCCTCAATTTAGGG + Intergenic
974205650 4:58700016-58700038 GGGGTTGGTTCCTTCTTTGGAGG + Intergenic
974456361 4:62133743-62133765 AGGGTTGCTTCCTCCAGAGAAGG - Intergenic
975327210 4:73072087-73072109 AGCCTTGTTTCTTCCTATGAGGG - Intergenic
975913894 4:79299701-79299723 AGCATTGTTTCCTCATTTTATGG + Intronic
976317743 4:83677296-83677318 AGGATTTTTTCCTCCTTTGCAGG + Intergenic
977284719 4:95088391-95088413 AGGCTTTTTTCCTCCTTTATTGG + Intronic
981749002 4:148075597-148075619 AGGGTTGGTTCCTTCAGTGAGGG - Intergenic
984072719 4:175135729-175135751 TGGCTTTTTTCCTCTTTTGAAGG - Intergenic
985800284 5:2001374-2001396 AGGCTTGTTACTTCCTGTGATGG + Intergenic
987106335 5:14643473-14643495 AGAATTCTTTCCTCCTTTTATGG + Intergenic
988614732 5:32764408-32764430 AGTGTTGTCTCTTCTTTTGAGGG + Intronic
989228551 5:39059699-39059721 AGGATTGTTTCAACCTTGGATGG - Intronic
989855582 5:46284446-46284468 AGAGTTAATTCCTTCTTTGATGG - Intergenic
991984140 5:72265962-72265984 ATGGTTTTTTCCTCCTATGAAGG + Intronic
995848831 5:116523174-116523196 AGGCATGTTTCCTCCTTTTTTGG + Intronic
998612810 5:143707497-143707519 TGGGTTGTTACCTCATTTGAAGG + Intergenic
1000200488 5:159005136-159005158 TGGGTTGTTTCCTCCCTTGTGGG - Intronic
1000331197 5:160206908-160206930 AAGGTTTTTTTCGCCTTTGAAGG - Intronic
1001375746 5:171256056-171256078 AGGGTTTTTTCTTTCCTTGATGG + Intronic
1001811047 5:174628487-174628509 GGGGTTGTTTCCTCTTTGGGAGG + Intergenic
1001987596 5:176088433-176088455 ATGGTAGTTTCTCCCTTTGAAGG + Intronic
1002229274 5:177749707-177749729 ATGGTAGTTTCTCCCTTTGAAGG - Intronic
1003624863 6:7731512-7731534 AGCGTGGTTTCCGCCTTTGGAGG - Intronic
1004753270 6:18585081-18585103 AGGCTTGTGTCACCCTTTGAGGG + Intergenic
1006271082 6:32968342-32968364 AGGCTTGTTTCCTCCTCGGTGGG - Intronic
1007023833 6:38549676-38549698 AGGGTGGTTCCCTACTCTGAAGG - Intronic
1007661434 6:43489232-43489254 AGAGTTGTTTCTGCCGTTGATGG + Intronic
1008378936 6:50821377-50821399 AGGGTTGCTTCATCATTTGGAGG - Intronic
1011238252 6:85241737-85241759 TGGGTTTTTTTCTCTTTTGATGG + Intergenic
1017120792 6:151022151-151022173 AGGGGTGTTTCCTCCTCTGCTGG + Intronic
1018010147 6:159662427-159662449 AGAGTTGTTTGTTCCTTTGGTGG - Intergenic
1021522961 7:21555071-21555093 AGGCTTCTTTTCTTCTTTGAAGG + Intronic
1022046681 7:26627408-26627430 GGGGTTGTTGACTCCTCTGAGGG + Intergenic
1022373760 7:29794038-29794060 ATGGTTCACTCCTCCTTTGATGG - Intergenic
1022603149 7:31780925-31780947 TGGGTTGTTTACTCCTTAAATGG - Intronic
1023887646 7:44371972-44371994 AGGGTTTTTTCCCCCTTTGATGG - Intergenic
1024014217 7:45296442-45296464 AGGGATGTTTCCTCCTAGGCAGG - Intergenic
1024048021 7:45598270-45598292 ATGGCTGTTTCCTCCTTTCGTGG + Intronic
1024883587 7:54116453-54116475 AGGGGTATTTCCTCCTTGCAAGG + Intergenic
1027769666 7:82390987-82391009 TGGGTTTTTTCCTCCTTCTAAGG + Intronic
1028109352 7:86920618-86920640 ATGTTTGTTTCCTCCTGCGAGGG - Intronic
1028665533 7:93339151-93339173 AGGGTTATTTCCTTTTTAGAGGG + Intronic
1033333368 7:140433266-140433288 AGGGCTGTTTGCTCCATGGATGG - Intergenic
1033651448 7:143346635-143346657 TGGGTTGTTTTCTTCTTTGTGGG - Exonic
1033956195 7:146851541-146851563 AGGGTTGACTCCTCCTCTGAGGG + Intronic
1033956414 7:146854232-146854254 ATGGTGGTTTCCTCTGTTGAAGG + Intronic
1035096218 7:156357982-156358004 AGGGTTGTATCAGCATTTGAGGG - Intergenic
1037575787 8:20201307-20201329 TGGGTTTTTTCCTGTTTTGAAGG + Intronic
1040455337 8:47592459-47592481 AGGATTCCTTCCCCCTTTGAGGG - Intronic
1040505691 8:48045854-48045876 ACAGTTGTTTTCTCCTTAGAAGG + Intronic
1045942391 8:107754749-107754771 AGATTTTTTTTCTCCTTTGAAGG + Intergenic
1046370998 8:113306295-113306317 AGGGTTGGTTCCAACTCTGAAGG + Intronic
1047059441 8:121207851-121207873 AGGTATGTTACTTCCTTTGAAGG + Intergenic
1047568619 8:126073473-126073495 ATGTTTGTTTCCTCCTTCCAAGG - Intergenic
1047676201 8:127205852-127205874 TGGGTTTTTTTCTCTTTTGAGGG - Intergenic
1054871405 9:70049988-70050010 AGGGATGTTTCCTCCAATGCTGG - Intronic
1058658158 9:107243889-107243911 CGTGTTCATTCCTCCTTTGATGG - Intergenic
1059584795 9:115594606-115594628 AGGGTTGTTTTCTCCCTCCAGGG - Intergenic
1060159653 9:121349579-121349601 AAACTTGGTTCCTCCTTTGAAGG + Intronic
1185827540 X:3266370-3266392 ATGGTTATTTCCTCCTCTCAGGG - Intergenic
1186670286 X:11759602-11759624 ACGGATGTTTCCTATTTTGAAGG + Intronic
1187035486 X:15534438-15534460 AGGATTTTTTCCTACTTTCATGG - Intronic
1189113011 X:38313154-38313176 AGAGTTGTTTCCATCTTTCATGG + Intronic
1190014581 X:46815911-46815933 AGGTTTTTTTTCTCCTTTTATGG - Intergenic
1190172354 X:48121702-48121724 ATGGTAGTTTCCTCCTTCCAAGG - Intergenic
1191872286 X:65758216-65758238 TGGGTTGTTTTCACCTTTTAAGG - Intergenic
1191896398 X:65997991-65998013 AGGGTGGTGTCCTCCTATGTGGG - Intergenic
1194134030 X:90116520-90116542 AGGGTTTTTTCTTTCCTTGATGG + Intergenic
1197809229 X:130426930-130426952 ACAGTGGTTTCATCCTTTGAGGG - Intergenic
1200479809 Y:3686635-3686657 AGGGTTTTTTCTTTCCTTGATGG + Intergenic
1201406244 Y:13653082-13653104 AGGGTTGTCTCCTGCTGGGATGG - Intergenic
1202076973 Y:21045866-21045888 AGGGTTGTTACCTTATTTGAGGG - Intergenic