ID: 1098073534

View in Genome Browser
Species Human (GRCh38)
Location 12:66701141-66701163
Sequence TTTTCTACACACATCCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098073527_1098073534 13 Left 1098073527 12:66701105-66701127 CCAAAACCCGTGCAACTAATAAA 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1098073534 12:66701141-66701163 TTTTCTACACACATCCATTATGG 0: 1
1: 0
2: 0
3: 11
4: 171
1098073528_1098073534 7 Left 1098073528 12:66701111-66701133 CCCGTGCAACTAATAAACACAAA 0: 1
1: 0
2: 0
3: 28
4: 309
Right 1098073534 12:66701141-66701163 TTTTCTACACACATCCATTATGG 0: 1
1: 0
2: 0
3: 11
4: 171
1098073529_1098073534 6 Left 1098073529 12:66701112-66701134 CCGTGCAACTAATAAACACAAAC 0: 1
1: 0
2: 0
3: 33
4: 387
Right 1098073534 12:66701141-66701163 TTTTCTACACACATCCATTATGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098073534 Original CRISPR TTTTCTACACACATCCATTA TGG Intronic
903507109 1:23844821-23844843 ATTTCTAAACATATCTATTAAGG + Intergenic
905698729 1:39995791-39995813 TTTTCTACACAAAGACATAAAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906584114 1:46961441-46961463 TTTTCTACACTCACCCACTCTGG + Intergenic
906974680 1:50557150-50557172 TTTTCTACACACCTCAGCTAAGG - Intronic
908418121 1:63933054-63933076 TTTTCAACACAAGTCAATTAAGG - Intronic
910480315 1:87651611-87651633 TTTCTTAAACACATTCATTAGGG + Intergenic
911717350 1:101148494-101148516 TTTTCTAAACATGTCCATTATGG - Intergenic
912005337 1:104892094-104892116 TTTTCTGAACATATCCATAATGG - Intergenic
912870634 1:113301719-113301741 TGTTCTCCACACATACTTTAGGG + Intergenic
915277775 1:154801335-154801357 TTTTCTATCCACAATCATTAGGG + Intronic
915402756 1:155635835-155635857 TTTTCCCCACACATCCCCTATGG + Intergenic
915871058 1:159560058-159560080 TTTCCTTCACACAACCCTTAAGG - Intergenic
916609095 1:166372746-166372768 TTATCTTCACACATCCTTTAAGG + Intergenic
917608543 1:176661941-176661963 TTTTGTACACACTTCTATTGTGG + Intronic
918815599 1:189177062-189177084 TTTTCTACACTCATCTGTCATGG + Intergenic
919658784 1:200222894-200222916 TTTTGTACCCACAACCATCATGG - Intergenic
920666382 1:207965635-207965657 TTTTCTACAAGCATCCTTTTTGG - Intergenic
921785498 1:219224611-219224633 TTTTCTGAACACTACCATTATGG - Intergenic
921966639 1:221097457-221097479 TGTTCTACACACATTCATTGTGG - Intergenic
924897034 1:248350420-248350442 TCTTCTCCATACATCCATTAAGG + Intergenic
1064421238 10:15192634-15192656 CTTTCTGCACACCTCCATTATGG + Intergenic
1067664284 10:48261090-48261112 TTTTCTTCACATTTCCATTTGGG - Intronic
1067897081 10:50194229-50194251 TTTTCTACTCATGTCCATGAGGG - Intronic
1067951891 10:50747811-50747833 TTTTCTACTCATGTCCATGAGGG + Intronic
1068773494 10:60848092-60848114 TTCTCTACACAAATCCACAAAGG - Intergenic
1071141986 10:82520226-82520248 TTTTCTGTCCACATCCATTAAGG + Intronic
1074940936 10:118235592-118235614 TTTCCTGCACGCATCCTTTAAGG - Intergenic
1076115879 10:127899573-127899595 TTTTCTAAATACATCCAGGAGGG + Intergenic
1078519435 11:12051407-12051429 TATTCCACCCACATCCCTTATGG + Intergenic
1080395725 11:31888111-31888133 TTTTCTCCACACAGCAATCAAGG - Intronic
1080929533 11:36794261-36794283 TTTTCTAGAAATATGCATTATGG - Intergenic
1081011850 11:37822773-37822795 TTTTTGACACAAATCCATAAAGG - Intergenic
1081476768 11:43440916-43440938 TTGTCTACACACATACATACAGG - Intronic
1085431829 11:76458643-76458665 TTTTCTAATGTCATCCATTAAGG - Intronic
1088402500 11:109436602-109436624 ATTTCTACACACTTTCATTCGGG + Intergenic
1088948478 11:114539468-114539490 TTTTCAAAATACCTCCATTAAGG - Intronic
1088986221 11:114910710-114910732 TCTTCAACACACCTACATTAAGG - Intergenic
1089381555 11:118036447-118036469 TTTTCTAAACACATCTTTAATGG + Intergenic
1090700342 11:129289298-129289320 TTTTGTGCACTCAACCATTAAGG + Intergenic
1091084587 11:132708803-132708825 TTTTCTTTACACATACATTATGG + Intronic
1093230954 12:16541025-16541047 TTTAATACACACATATATTAGGG + Intronic
1098073534 12:66701141-66701163 TTTTCTACACACATCCATTATGG + Intronic
1098441300 12:70522004-70522026 TTTACTATACAGATCAATTAGGG + Intronic
1098545705 12:71708561-71708583 CTTTATATACCCATCCATTATGG + Intergenic
1099318751 12:81118484-81118506 CTTTCTACACACATCCCATTTGG + Intronic
1100356884 12:93839290-93839312 ATTCCTACACAGATCCATGAGGG - Intronic
1103143582 12:118574054-118574076 TTTTCTACATACATTGCTTAAGG + Intergenic
1105496996 13:20939089-20939111 ATTTTTATACACATCCGTTAGGG + Intergenic
1106052499 13:26204625-26204647 TCTTCTAAACACATCCTTTTTGG - Intronic
1106773742 13:32988112-32988134 TTTTCTACAAACACCCAAAAAGG - Intergenic
1108161270 13:47642332-47642354 TTTTCTACACACATCAGATTTGG - Intergenic
1110586217 13:77196586-77196608 TCTTTTACACACATCCACTTCGG - Intronic
1110734125 13:78914658-78914680 TATTCTATACACACCCATAATGG - Intergenic
1111936283 13:94560565-94560587 TTTTATCCTCACATACATTATGG - Intergenic
1112802685 13:103130009-103130031 TTTTCTTCACTCATTTATTAAGG - Intergenic
1115718509 14:36133080-36133102 TTTACTACATACAGCCATTATGG - Intergenic
1116632781 14:47355919-47355941 TTTTCTGCTCTCAACCATTAAGG + Intronic
1117748279 14:58893490-58893512 TTTTCTAGACAAATCTATTCTGG + Intergenic
1118460844 14:65985736-65985758 TGTTCTCCACACATCTATCATGG + Intronic
1119300114 14:73565131-73565153 ATATTTACACACATTCATTAAGG + Intergenic
1125140577 15:36401801-36401823 TTTGCTACATACATCCAGTGTGG + Intergenic
1126384289 15:48077916-48077938 TTTTCTTCAAACTTCCCTTAAGG - Intergenic
1132420026 15:101657530-101657552 ATTTCTACACAGCTCTATTAGGG - Intronic
1133451312 16:5906117-5906139 TTTTCTTGACACAAGCATTAGGG + Intergenic
1133692876 16:8233440-8233462 TTTTCTACAAACATTCCTAATGG + Intergenic
1137831999 16:51552851-51552873 TCCTCTGCACACTTCCATTAGGG - Intergenic
1142826915 17:2518937-2518959 TTTTCTACAAAAATCCTTTTGGG + Intergenic
1143238214 17:5421045-5421067 TATTATGCACACAACCATTAAGG + Intronic
1146337573 17:31988198-31988220 TTTTCAAGACAAATCTATTAAGG + Intronic
1150597533 17:66619520-66619542 TTTTATAAAAATATCCATTAAGG + Intronic
1156062908 18:33102721-33102743 TTTTCTACAGATAACCATTTCGG + Intronic
1156104790 18:33647150-33647172 ATTTCTGCAAACATCCTTTAAGG - Intronic
1158317925 18:56232017-56232039 ATTCCTACAAACCTCCATTATGG - Intergenic
1163223231 19:15936839-15936861 TGTTCTGCACCCATTCATTAGGG + Intergenic
1167949864 19:53017583-53017605 TTTTCTCCACTCATCCACTGTGG + Intergenic
1168485878 19:56761395-56761417 TTTTATCCAGACATCCATCAGGG - Intergenic
927105049 2:19817018-19817040 TATTCTACATACTTCCATGAAGG - Intergenic
929127634 2:38535856-38535878 TTATGTACACACATACATGAAGG + Intergenic
929519751 2:42637221-42637243 TTTTCTACACAGAACCACAAAGG - Intronic
929852493 2:45605258-45605280 TTTTCTACCCACATCACTTAAGG + Intronic
931198101 2:60072349-60072371 CTTTCAACAAACATCCATCAAGG - Intergenic
931554240 2:63482411-63482433 TTTTGTGCACATATCCAGTATGG - Intronic
932983230 2:76696032-76696054 TTTTATACACACATATATAAGGG - Intergenic
933256284 2:80084633-80084655 CTTTCTACACACCTCCAGGATGG + Intronic
936913682 2:117617674-117617696 ATTTCCACAAACATCCATTGTGG - Intergenic
936971416 2:118179750-118179772 AGTTCTATACACATCCATTCAGG - Intergenic
937886857 2:126905722-126905744 TGTTCTCCACACATGCCTTATGG + Intergenic
938840407 2:135156528-135156550 TTTTCTACTTAAATCTATTAAGG - Intronic
939771925 2:146332157-146332179 TGTTCTACAAATATTCATTAAGG + Intergenic
940766449 2:157795119-157795141 TGTTCTACAAACATCAAATATGG + Intronic
941406875 2:165100743-165100765 TTTTAAGCACACATCCATGAAGG - Intronic
941658897 2:168174177-168174199 TTCTCTACAAACACCAATTAAGG - Intronic
942423065 2:175828129-175828151 TTTTGTACACAAATCCATATGGG + Intergenic
944448675 2:199818937-199818959 TTTTCCTGACACATCCCTTAGGG + Exonic
1170896003 20:20414887-20414909 ATTTAGACAAACATCCATTAGGG + Intronic
1179290154 21:40011437-40011459 TTCTCTACAGGCTTCCATTAAGG - Exonic
1179360236 21:40699593-40699615 TTTTCTCCACACCACCAGTAAGG - Intronic
1179402017 21:41093247-41093269 TTATTGACACACATTCATTAAGG + Intergenic
1182163614 22:28149361-28149383 TTTTATCCACTCATCCATGATGG - Intronic
1185170925 22:49293717-49293739 TTTTCTTCATAAATCCCTTAGGG - Intergenic
949569479 3:5278715-5278737 AATTTTATACACATCCATTATGG + Intergenic
950167011 3:10808824-10808846 TTTTCTACTTAAATCAATTAGGG + Intergenic
950691724 3:14664029-14664051 TTTTCTTCCCCCATCCATTTGGG + Intronic
950955057 3:17044151-17044173 TTCTCTGCACACAGCTATTATGG - Intronic
955479191 3:59372084-59372106 TTTTTTTTACACCTCCATTATGG + Intergenic
956484248 3:69704663-69704685 TTTTATACACACATATATTTAGG + Intergenic
956940101 3:74149516-74149538 CTTTCTACATGCATTCATTAAGG - Intergenic
957937515 3:86963954-86963976 TCTTCTACACACATTCATGCAGG - Intronic
959126622 3:102297436-102297458 CTTTCCACACACCTCCATTATGG + Intronic
959929637 3:111965342-111965364 ATTACAAAACACATCCATTAAGG - Intronic
960436408 3:117632445-117632467 GTTTGTCCACATATCCATTAGGG - Intergenic
962257025 3:133879082-133879104 CTTTCTTCATACATCCAATAAGG + Intronic
962420789 3:135226815-135226837 TTTTCTTAACACAGTCATTAAGG + Intronic
962559993 3:136595745-136595767 TTTTAAACACTGATCCATTAGGG - Intronic
965829000 3:172761185-172761207 TTTGCTACACAAATACACTAAGG - Intronic
966629626 3:182058157-182058179 TTTACTACACACATACACTTGGG + Intergenic
970797781 4:19934821-19934843 GTTTATCCACTCATCCATTATGG - Intergenic
971283131 4:25258703-25258725 TTTTCTAAAAATATTCATTAAGG - Intronic
973818778 4:54643918-54643940 TTTTCTACACATTTTCATGAAGG - Intergenic
975431701 4:74299842-74299864 TTTTATACCTACCTCCATTATGG - Intronic
978850072 4:113324429-113324451 TATTATACAGCCATCCATTATGG + Intronic
978891472 4:113832874-113832896 TTTTCTTTACCCTTCCATTATGG - Intergenic
981516989 4:145620047-145620069 TTTTCTAAACATATGGATTAGGG - Intronic
983068313 4:163237561-163237583 TTTTCTAGAGACATCCCTAAAGG + Intergenic
983451643 4:167919113-167919135 TTTGCTACTCAAATCCATTTTGG - Intergenic
985239298 4:187912988-187913010 ATCTCTACACATATCCATTTTGG - Intergenic
987645322 5:20663744-20663766 TTTTCTACTTACGTTCATTATGG - Intergenic
987883720 5:23784080-23784102 ATTTGTACACACATACATAAAGG - Intergenic
989537261 5:42578512-42578534 TGTTACACACACATTCATTAAGG - Intronic
993005138 5:82421570-82421592 TTTTCTACACCTCTTCATTAGGG - Intergenic
994011555 5:94909577-94909599 TTTTCAGGACACATCCATTGAGG - Intronic
994185438 5:96810012-96810034 CTTTCTGCCCACATCCATTCAGG - Intergenic
995085843 5:108108394-108108416 TTTTCTAAACACTTTCATTAAGG - Intronic
1000531520 5:162427475-162427497 TCTTTTATACATATCCATTAAGG - Intergenic
1000658035 5:163906013-163906035 TTTTCCACATACATGCATCAAGG + Intergenic
1003737450 6:8892742-8892764 TGTTCAACAGAAATCCATTAAGG - Intergenic
1005664324 6:28035791-28035813 ATTTATACACACAAGCATTATGG + Intergenic
1005730477 6:28692414-28692436 TTTACTACACAGACCCTTTATGG - Intergenic
1007143901 6:39607930-39607952 TTTTCCACACACATCCCACAAGG + Intronic
1007917736 6:45576745-45576767 TTTCTCACACACATCCATGAGGG - Intronic
1007917827 6:45577371-45577393 TTTCTCACACACATCCATGAGGG - Intronic
1008781793 6:55115910-55115932 TATTTTACACACATACATCATGG - Intronic
1008803928 6:55404940-55404962 TTTTCTACACACATCTTTCCTGG + Intergenic
1012867219 6:104632847-104632869 TTTGCTACACCCATCCCATAAGG + Intergenic
1013077692 6:106785757-106785779 TTTTCTACTTACATCCACTTAGG + Intergenic
1013107756 6:107040514-107040536 TTTGCTACATACATCTAATATGG - Intronic
1020457011 7:8385421-8385443 TGTTCCACACAAATCTATTAAGG - Intergenic
1021080159 7:16354851-16354873 TTTTTTACATACATGCCTTAGGG - Intronic
1021262365 7:18473932-18473954 TGTTCCACACACATCACTTAGGG + Intronic
1022326221 7:29334354-29334376 TTTTCTACACTCATCATGTAGGG - Intronic
1022763673 7:33385289-33385311 TTTGTTACACACATAAATTAAGG + Intronic
1029954289 7:104621262-104621284 TTTTCTATACTAATCCATAAAGG - Intronic
1031004360 7:116455774-116455796 TTTTCAACTCAAATCCATTTTGG + Intronic
1031075617 7:117209340-117209362 TTTTCTATACACATGTATCAAGG - Intronic
1031683357 7:124702309-124702331 TTCTCTATACACAGCTATTATGG - Intergenic
1032747503 7:134801933-134801955 TTTTCTTCTCACATCTATTTAGG + Intronic
1033806190 7:144956672-144956694 TCTTCTACTCAGATCCATCACGG - Intergenic
1033824201 7:145169553-145169575 TCATCTACACATTTCCATTAAGG + Intergenic
1038530747 8:28316550-28316572 TTTTCTACTCACAACCATCCTGG + Intergenic
1039353697 8:36792067-36792089 TTTTCTACACTGATCATTTACGG + Intronic
1040891430 8:52321136-52321158 TTTTCTGCACACATGCATATAGG - Intronic
1042058822 8:64795053-64795075 TTTTCTATCCACAACCATTTCGG - Intronic
1043739385 8:83790716-83790738 TTTTATAAACAAATCTATTAGGG - Intergenic
1047088265 8:121543829-121543851 TTTTCTAAAGACATGCAATATGG + Intergenic
1047982122 8:130194075-130194097 TTATCTACACACATTCTTGAGGG + Intronic
1049689133 8:143951116-143951138 GTTTCTAAACACATCCTTCAAGG + Intronic
1053096672 9:35334520-35334542 TTTTCTACCTACATGCACTAGGG - Intronic
1054952981 9:70873718-70873740 TTTTGGTCACACTTCCATTAGGG + Intronic
1056278703 9:85018678-85018700 TTTACTACCCACATCCTTTCTGG + Intronic
1056319001 9:85419102-85419124 TTTTATATACATATACATTATGG - Intergenic
1059514912 9:114884240-114884262 TTTTCTACTCACTTTCATAATGG + Intergenic
1060459229 9:123833429-123833451 TTTTCTCCACAAATTCCTTAGGG + Intronic
1060909722 9:127339968-127339990 TTCTCTACACTCACCCACTAAGG + Intronic
1186903312 X:14082816-14082838 TTTTCTGTACACATCATTTAAGG + Intergenic
1190847664 X:54209226-54209248 TTAACTACACACATACATTGTGG + Intronic
1191642676 X:63444821-63444843 TTTTCAACATTCATCCATTTTGG + Intergenic
1193872875 X:86823385-86823407 TTTTATACACAACTCCTTTAAGG + Intronic
1194971597 X:100349928-100349950 CTCTGTACTCACATCCATTATGG + Intronic
1195216273 X:102706747-102706769 ATTTCAGCACCCATCCATTATGG + Intergenic
1197110252 X:122764211-122764233 TTTTATACTCACATCCACAAGGG + Intergenic
1197231856 X:124013961-124013983 TTTTCTACAGACATCAAAAATGG + Intronic
1198391427 X:136179066-136179088 ATTTCTGTACACATTCATTAGGG + Intronic