ID: 1098074326

View in Genome Browser
Species Human (GRCh38)
Location 12:66711840-66711862
Sequence CCCATAGTGTTCACGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098074326_1098074329 22 Left 1098074326 12:66711840-66711862 CCAAGCTGCGTGAACACTATGGG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1098074329 12:66711885-66711907 TCAAATCTAGATCATTTAGTTGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098074326 Original CRISPR CCCATAGTGTTCACGCAGCT TGG (reversed) Intronic