ID: 1098074326 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:66711840-66711862 |
| Sequence | CCCATAGTGTTCACGCAGCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 45 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 40} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098074326_1098074329 | 22 | Left | 1098074326 | 12:66711840-66711862 | CCAAGCTGCGTGAACACTATGGG | 0: 1 1: 0 2: 0 3: 4 4: 40 |
||
| Right | 1098074329 | 12:66711885-66711907 | TCAAATCTAGATCATTTAGTTGG | 0: 1 1: 0 2: 2 3: 11 4: 152 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098074326 | Original CRISPR | CCCATAGTGTTCACGCAGCT TGG (reversed) | Intronic | ||