ID: 1098075396

View in Genome Browser
Species Human (GRCh38)
Location 12:66724446-66724468
Sequence ATGATGTATTTGATGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 430}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098075396 Original CRISPR ATGATGTATTTGATGAAATA AGG (reversed) Intronic
901557815 1:10045542-10045564 CTGACATATTTGATGAAATATGG + Intronic
902354316 1:15886081-15886103 ATGCTGTATTTGACCAAAAAAGG - Intronic
902662099 1:17912021-17912043 ATGATTTATTTGCTGAATCAGGG + Intergenic
903426995 1:23261153-23261175 ATGCTGTATCTGTTTAAATAAGG + Intergenic
904018129 1:27440174-27440196 ATCCTAAATTTGATGAAATATGG - Intronic
904372146 1:30056046-30056068 CTGATGTATTAGCTGAAGTAAGG - Intergenic
905928212 1:41767134-41767156 ATGATGCATTTGATGAGATGTGG - Intronic
906665104 1:47615896-47615918 ATGAGGAATTTGATCATATATGG + Intergenic
907552338 1:55314912-55314934 ATGCTGGTTTTGATGACATAAGG - Intergenic
907628527 1:56056272-56056294 ATGATGTATTTAATTTAATCTGG - Intergenic
907948835 1:59161182-59161204 ATCATGTATATGATGAAGCAGGG - Intergenic
908042521 1:60129944-60129966 ATGATGTATTTTATGACAAAAGG + Intergenic
908376606 1:63548559-63548581 AAGAAATATTTGAAGAAATAAGG - Intronic
908916804 1:69137456-69137478 ATAAAGTATTTGATAAAAAAAGG + Intergenic
909195464 1:72616084-72616106 ATGATGTCTTTTTGGAAATAGGG + Intergenic
909253580 1:73389607-73389629 ATGTTGAATTTGATGACATTTGG - Intergenic
909594140 1:77386176-77386198 ATAATGTATTTGATTTACTAAGG - Intronic
909750067 1:79148343-79148365 ACAATGGGTTTGATGAAATAGGG - Intergenic
909909287 1:81242020-81242042 ATAAAATATTTAATGAAATAAGG + Intergenic
910382037 1:86637534-86637556 AAAATGTATTTGAGGAAAGAGGG + Intergenic
910760224 1:90725504-90725526 GTGATGTGTGTGCTGAAATAGGG + Intergenic
911780523 1:101870290-101870312 ATGATGTTATTGATGAATTATGG - Intronic
912001450 1:104840413-104840435 AATATGTATTTAATAAAATAAGG + Intergenic
912024571 1:105152093-105152115 ATGAATTATTTCATAAAATATGG - Intergenic
912506287 1:110158802-110158824 ATTTTGGAATTGATGAAATAAGG - Intronic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
912988930 1:114464375-114464397 ATGTTGTAGTTGGTGTAATACGG - Exonic
913240211 1:116823512-116823534 GTTTTCTATTTGATGAAATATGG + Intergenic
913398777 1:118404712-118404734 AAAATATATTTGAAGAAATAGGG + Intergenic
915010741 1:152683920-152683942 ATGTTGTAAGTGAGGAAATAGGG - Intergenic
917264523 1:173206395-173206417 ATGATGTATTTAATAAGGTAGGG + Intronic
917362071 1:174187565-174187587 AGTATGCATTTAATGAAATATGG + Intronic
918234694 1:182569446-182569468 ATGATGCATCTAATGAAAAAAGG - Intergenic
918287921 1:183076658-183076680 ATGGGGGATTTGATGAAATATGG - Intronic
918900593 1:190411622-190411644 ATGAAGGCTTTGAGGAAATATGG + Intronic
918987812 1:191656099-191656121 ATCATTTAGATGATGAAATATGG - Intergenic
919051819 1:192520814-192520836 AAGATGTATTTAAAGAAAGAGGG - Intergenic
919078693 1:192843855-192843877 ATGATCTAGTTGAGGAAATAAGG + Intergenic
919147808 1:193656922-193656944 TTGATGTATTGGCTGTAATATGG + Intergenic
919603815 1:199654878-199654900 ATGAGGTATATGATTTAATATGG - Intergenic
920668569 1:207985008-207985030 ATGTTGTTTTGGTTGAAATATGG + Intergenic
921859063 1:220021840-220021862 ATGATTTATTTTATAAAGTAGGG + Intronic
921934363 1:220783107-220783129 ATGAAATATGTTATGAAATATGG - Intronic
922639657 1:227215963-227215985 ATGATCAATTTGACTAAATATGG + Intronic
923183337 1:231545143-231545165 ATATTTTATTTGATAAAATAAGG + Intronic
924080103 1:240387150-240387172 ATGATGTAGTTTAAGAAAAAAGG - Intronic
924781788 1:247156449-247156471 TTCATGTATTTGAGGAAATCTGG + Exonic
924836858 1:247657515-247657537 ATGATTTATTTTATGAATTGTGG + Intergenic
924838323 1:247678141-247678163 ATGAAGTAGTTGGTGAAATTTGG + Intergenic
1062940720 10:1418772-1418794 TTGATGTATTTGCTGAACTTTGG - Intronic
1063280325 10:4621779-4621801 TTAATGTATTTAAAGAAATAAGG - Intergenic
1063679850 10:8176663-8176685 ATTATATATTTGAAGATATAGGG - Intergenic
1064757397 10:18583652-18583674 ATTCTCTATTTGATGAAACATGG - Intronic
1064908541 10:20373657-20373679 ATGAAGTATTAGAGAAAATATGG - Intergenic
1064969052 10:21045062-21045084 TGGATGTATTTGAAGAAAAAAGG - Intronic
1065559440 10:26947235-26947257 AAGATATGTTTGATGAAAGAAGG - Intergenic
1065720312 10:28622499-28622521 ACAATATATTTGATGAAAGAAGG + Intronic
1066416522 10:35226828-35226850 ATGAGGTATTTTATTAAATGAGG - Intergenic
1067723367 10:48747389-48747411 CTGATGTCTTTTATAAAATATGG + Intronic
1068579514 10:58723228-58723250 ATAATGTATTTGATGTAAACTGG + Intronic
1068581864 10:58750347-58750369 ATTTTAGATTTGATGAAATAGGG - Intronic
1068708591 10:60105660-60105682 TTGATGTATGTGATTAAAGATGG + Intronic
1068714351 10:60171709-60171731 AAAATGTAGTTGATGCAATAGGG + Intronic
1068765651 10:60760132-60760154 ATGTTAGATTTGATGAAGTAAGG - Intergenic
1068836521 10:61560734-61560756 AAGAAATATTTGATAAAATAAGG + Intergenic
1069217034 10:65833593-65833615 ATGTTTTAATTAATGAAATATGG + Intergenic
1070082708 10:73204700-73204722 ATGATGGAGTTACTGAAATAAGG + Intronic
1071042501 10:81330673-81330695 ATGATGTATTTTAAGGAATAGGG - Intergenic
1071241221 10:83707336-83707358 TTGATGAATATGATGAAATCTGG + Intergenic
1073227644 10:101937097-101937119 ATGATGTATTGAAAGGAATATGG - Intronic
1073664553 10:105515989-105516011 ATGATTCCTTTGATGAAATAGGG - Intergenic
1075293309 10:121249802-121249824 ATTTTATGTTTGATGAAATATGG - Intergenic
1079546122 11:21633873-21633895 ATGATGAATTAAATGAAATTTGG + Intergenic
1079910295 11:26301177-26301199 ATAATGTATTTAATAAACTATGG + Intergenic
1080064293 11:27992338-27992360 ATTATGAACATGATGAAATAAGG + Intergenic
1080235726 11:30066369-30066391 AAGATGAAATTAATGAAATAAGG - Intergenic
1081197629 11:40180567-40180589 ATGATTTTTTTGTTGGAATATGG + Intronic
1081302512 11:41469557-41469579 ATACTGAATTTGATTAAATAAGG - Intergenic
1081477131 11:43445335-43445357 ATCTTAGATTTGATGAAATATGG + Intronic
1082013247 11:47465290-47465312 ATGATATGTTCTATGAAATAAGG - Intergenic
1082019045 11:47515833-47515855 GTGCTGTATTTGGTAAAATAAGG + Intronic
1083312507 11:61791803-61791825 ATAATGTCTTTTATGAAAGAGGG + Intronic
1083677960 11:64337816-64337838 ATCTTAGATTTGATGAAATATGG - Intergenic
1083976055 11:66121335-66121357 ATACTGTATCTCATGAAATAGGG - Intronic
1085359561 11:75874504-75874526 GTCTTGGATTTGATGAAATATGG + Intronic
1086800337 11:91166004-91166026 ATTATTTATTTGATGACGTATGG + Intergenic
1088497946 11:110450964-110450986 ATGATGTATATGAAGGAATGAGG - Intronic
1088518678 11:110668942-110668964 TTTATATATTTTATGAAATAAGG - Intronic
1089595163 11:119574008-119574030 AAGATGTATTTGAAGAGAGATGG - Intergenic
1090996933 11:131875120-131875142 ATTCTATATGTGATGAAATAAGG - Intronic
1091970462 12:4782351-4782373 TTTATGTATTTCATGAAATTAGG + Intronic
1092097569 12:5856173-5856195 ATTATGTTTTTGGTGAAAGATGG + Intronic
1092318905 12:7450115-7450137 ATAAAATATTTGAGGAAATATGG + Intronic
1092950282 12:13496766-13496788 ATGCTAGATTTGATGCAATATGG - Intergenic
1092977785 12:13762343-13762365 AAGATGATTTTGATGAGATAAGG - Intronic
1093561343 12:20545027-20545049 GTGAGGTATTTTATGAAAAATGG - Intronic
1093568526 12:20637888-20637910 ATGATGGATTTGCTGTACTATGG + Intronic
1094269607 12:28598558-28598580 ATCATGTATAAGATGAAACATGG - Intergenic
1095231483 12:39745459-39745481 ATTTTGTATTTCATAAAATAGGG + Intronic
1098075396 12:66724446-66724468 ATGATGTATTTGATGAAATAAGG - Intronic
1098512662 12:71336353-71336375 ATTTTGTAATTGAAGAAATAAGG + Intronic
1098677026 12:73302446-73302468 ATGATGTAATGAATGAAAGATGG + Intergenic
1098855541 12:75648933-75648955 ATGATAAATTTTAGGAAATAAGG + Intergenic
1099724478 12:86409216-86409238 ATCATTTATTTGATAAAATTTGG - Intronic
1099804967 12:87507430-87507452 AAGAAGTACTTGAAGAAATACGG + Intergenic
1100376613 12:94022167-94022189 ATATTAGATTTGATGAAATATGG - Intergenic
1100778800 12:98001731-98001753 ATTATCTATTTGAAGACATAAGG + Intergenic
1100996942 12:100311411-100311433 AAGAATTATTTGATTAAATAGGG + Intronic
1102366170 12:112337306-112337328 ATGATATACTTGATGAGACAAGG + Intronic
1103946248 12:124528291-124528313 ATGATGAATCTGATGTAATTAGG + Intronic
1104170864 12:126278950-126278972 AAGTTTTATTTGATGAAATGGGG + Intergenic
1105162580 13:17458014-17458036 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105165466 13:17503386-17503408 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105165926 13:17510697-17510719 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105167629 13:17537561-17537583 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105168880 13:17557285-17557307 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105170674 13:17585500-17585522 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105171747 13:17602148-17602170 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105183494 13:17784863-17784885 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105186399 13:17830223-17830245 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105191160 13:17904019-17904041 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105528338 13:21196409-21196431 AAGAAGTATTTAAAGAAATATGG - Intergenic
1106082450 13:26511609-26511631 ATGATGAATTTCCTAAAATAAGG + Intergenic
1106931719 13:34673161-34673183 CTGATTTATATGATGAAATCTGG + Intergenic
1108089652 13:46835219-46835241 ATGATGTTTGTGATGAAGAAAGG + Exonic
1108300714 13:49072185-49072207 ATTTTGTATATGTTGAAATATGG + Intronic
1108875651 13:55046204-55046226 CTGAAGTCTTTTATGAAATAAGG + Intergenic
1108962467 13:56251943-56251965 ATTATGTATATGATGAAATTAGG - Intergenic
1109533216 13:63680996-63681018 TAAATGTAGTTGATGAAATAGGG + Intergenic
1109842141 13:67932752-67932774 GAGATGTATTGGCTGAAATATGG - Intergenic
1110787577 13:79549019-79549041 CAGATGTATTTGCTGACATAAGG + Intronic
1110830767 13:80028252-80028274 ATGATGTAATTAATGGAACATGG - Intergenic
1111350254 13:87019589-87019611 ATGGTGGATTGGATAAAATATGG + Intergenic
1111618547 13:90693802-90693824 AAGATGTATTTGTTAAAATATGG - Intergenic
1111699935 13:91674128-91674150 ATCAAGTATTTGATGTTATATGG + Intronic
1111737500 13:92160594-92160616 ATTAAGTCTTTGATGAAATTTGG + Intronic
1111853867 13:93611005-93611027 ATGAGATGTTTGATAAAATATGG - Intronic
1112057190 13:95700620-95700642 TTGCTGTATTAGATGAAATAAGG + Intronic
1112306169 13:98276188-98276210 TTGATGTAATTGATGAAATGAGG + Intronic
1113271745 13:108682253-108682275 ATGATGAATATGATCTAATAGGG + Intronic
1113272674 13:108691824-108691846 ATGATATATTTGATGAACAGAGG + Intronic
1113322790 13:109252761-109252783 ATTTAGTATTTGATGATATAAGG - Intergenic
1113415096 13:110122943-110122965 CTCATGTAATTGATGAGATAAGG + Intergenic
1115086506 14:29521808-29521830 ATTATGTGTTTGACTAAATAAGG - Intergenic
1115115026 14:29870110-29870132 TTGATGGATTTCATGAAATATGG - Intronic
1115254532 14:31385130-31385152 ATGATATATTTTTTGAAACAGGG + Intronic
1116264544 14:42670662-42670684 ATGATGTTTTTCATCAAATCTGG - Intergenic
1116293905 14:43079611-43079633 CATATGTATTTGTTGAAATAGGG - Intergenic
1116425523 14:44785403-44785425 ATGATGTTTTAGATTAAGTAAGG - Intergenic
1117762396 14:59043860-59043882 ATTTTAGATTTGATGAAATAAGG - Intergenic
1118169891 14:63378489-63378511 TTCATGTTTTTGATCAAATATGG + Intronic
1118244272 14:64093642-64093664 ATCATCTATTTTATGAAATAGGG - Intronic
1121282419 14:92708902-92708924 GTGATGGATGTGCTGAAATATGG - Intronic
1124398699 15:29329826-29329848 ATCATGTATTTATAGAAATATGG - Intronic
1124643640 15:31418276-31418298 ATTATCTATTTGAAGAAATTAGG + Intronic
1125109299 15:36012573-36012595 ATGATGTATTGGATGAAATCTGG - Intergenic
1126734171 15:51714884-51714906 ATGACAGATTCGATGAAATATGG - Intronic
1128220179 15:65963578-65963600 GTCTTGTATTTGAAGAAATACGG + Intronic
1128258827 15:66217691-66217713 ATGAAGGATTAGATGAAACAAGG - Intronic
1129155206 15:73713358-73713380 ATCGTGTCTTTGGTGAAATAAGG - Exonic
1129804992 15:78448491-78448513 TTTATTTATTTGAAGAAATAAGG + Intronic
1131473899 15:92719746-92719768 TTGATGTATTTGATGATCAATGG - Intronic
1133438847 16:5803610-5803632 ATTAAGAACTTGATGAAATAGGG + Intergenic
1133542524 16:6770321-6770343 ATAATGTATTTAATGCAACAGGG + Intronic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1135198747 16:20418439-20418461 ATGATGTAATTGATAAAAGCAGG + Intronic
1136184555 16:28579147-28579169 AAGGTATATTTGATAAAATAAGG - Intronic
1137633664 16:49966882-49966904 ATGATGTACTAGAAGAAATGAGG - Intergenic
1138056446 16:53838923-53838945 ATTATGTATGTTATTAAATATGG + Intronic
1139106469 16:63832791-63832813 ACCATGCATTTGATGAAACATGG + Intergenic
1139793122 16:69456926-69456948 ATTATGTATTTGATTAAAAGTGG + Intronic
1140599892 16:76462588-76462610 CTGATACATTTGATGAAATCAGG + Intronic
1141319925 16:82998574-82998596 ATGAGGTATTGGATGAAACAAGG - Intronic
1144200151 17:12933828-12933850 AGAATTTATGTGATGAAATATGG - Intronic
1144420732 17:15095661-15095683 ATGATATATCTGCTGAAATATGG + Intergenic
1144497745 17:15759275-15759297 AAGGTGTATTTGAAGAAAGAGGG - Intergenic
1144629543 17:16863763-16863785 AAGGTGTATTTGAAGAAAGAGGG - Intergenic
1146774345 17:35599131-35599153 ATATTGTGTTTGATGAAATAGGG + Intronic
1148390091 17:47265844-47265866 GTGTTAGATTTGATGAAATATGG + Intronic
1149355764 17:55837681-55837703 ATGATGGATTTGAGGATGTAAGG - Intronic
1150542886 17:66121848-66121870 ATTCTGTATTTGATGTGATATGG + Intronic
1150965813 17:69967305-69967327 ATGAAGTATCTCATCAAATAAGG + Intergenic
1151335406 17:73436719-73436741 ATGGTGGATTGGATGAAATGTGG - Intronic
1153123290 18:1757873-1757895 GTGATGTATTGGAGGAAGTAGGG + Intergenic
1156552583 18:38033392-38033414 ATGATAGATTTCCTGAAATACGG + Intergenic
1157316564 18:46594731-46594753 ATGATGTGCTTAAAGAAATACGG - Intronic
1157374062 18:47147200-47147222 ATAATGTATCTGATGAAAGAGGG + Intronic
1157940840 18:51927621-51927643 TTGACCTATTAGATGAAATATGG - Intergenic
1158135967 18:54208579-54208601 AAAATGAATTTGTTGAAATAAGG - Intronic
1158180202 18:54706855-54706877 ATCATGCATTTGAGGAAAAATGG - Intergenic
1158688313 18:59635356-59635378 AGGATGTATTTCATCAAAAAGGG + Intronic
1159068789 18:63599158-63599180 ATCATATATTTGATAAATTAAGG - Exonic
1159254417 18:65927696-65927718 ATGATATATGTGAAGAGATATGG - Intergenic
1159261698 18:66021800-66021822 AAGATGTTTTGGATGATATATGG + Intergenic
1159679760 18:71334269-71334291 AGGATTTTTATGATGAAATAAGG - Intergenic
1159694231 18:71534421-71534443 AAGATGTATTTTGTGAAATCTGG + Intergenic
1160249548 18:77189624-77189646 ATGATGAATTTAATGTAAAATGG - Intergenic
1161877287 19:6921487-6921509 ATTATGGATTTGATGAAAGGAGG + Intronic
1162229285 19:9252220-9252242 ATGATGTGTATGATGAACAAAGG - Exonic
1164334062 19:24291982-24292004 TTGAAGTATGTGGTGAAATAGGG + Intergenic
1165972685 19:39645827-39645849 ATGATGTATTTGCTGGGAGAAGG - Intergenic
1167570290 19:50282897-50282919 TTGATGTTTTTGATCAAATGTGG + Intronic
1167757927 19:51424781-51424803 ATGATATTTTTAATGAAATTGGG - Intergenic
925541421 2:4971811-4971833 TTGATGTACTTTATTAAATAAGG + Intergenic
925642876 2:6003923-6003945 ATGATGAATTCCATGTAATAAGG + Intergenic
926571645 2:14535919-14535941 ATGATGCAGTTGATGATATTGGG - Intergenic
926924554 2:17973988-17974010 AGGATGTCTTTGATGAAAACTGG + Intronic
928529989 2:32181254-32181276 ATCTAATATTTGATGAAATATGG - Intronic
928909052 2:36400318-36400340 ATGATGTAGTTGATTGAAGAGGG + Intronic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
930917111 2:56706241-56706263 ATCATGTTTTTGAATAAATAAGG + Intergenic
931018761 2:58017735-58017757 TTGAAGTATGTGATTAAATATGG + Intronic
931227893 2:60349817-60349839 ATGAGTTCTTGGATGAAATAGGG + Intergenic
931234202 2:60399606-60399628 AACATGTATTTAATGAAAGAAGG - Intergenic
931995118 2:67832212-67832234 ATGATGTATTTAATGCATTTGGG + Intergenic
932078619 2:68690516-68690538 ACCATGGATTAGATGAAATAAGG + Intronic
932508050 2:72255732-72255754 ATGATTTAGGTGATGAAATGTGG + Intronic
932993202 2:76813339-76813361 ATGAGACATTTGATGAAAGATGG - Intronic
933612820 2:84455188-84455210 GTTTTATATTTGATGAAATATGG - Intronic
934097041 2:88616304-88616326 ATGATGTATTTGAAGAGTTGAGG - Intronic
936559571 2:113525217-113525239 ATGATGTGTTTGATCATTTATGG + Intergenic
936699146 2:114989029-114989051 ATAATGTAGTTTATGATATATGG - Intronic
937653871 2:124352158-124352180 TAGATGGATTTGATGAAATGAGG - Intronic
938548584 2:132358740-132358762 TTTTTGTATTTGGTGAAATATGG - Intergenic
938931662 2:136091466-136091488 AATATGTATTTGCTGAAAGATGG + Intergenic
939382588 2:141455182-141455204 CTGATGTATTTAATCAATTATGG + Intronic
940560127 2:155284444-155284466 AAAATCAATTTGATGAAATAAGG + Intergenic
940938611 2:159529205-159529227 ATGGAGTATTTCATGAAAAAAGG - Intronic
941062305 2:160861339-160861361 ATCAGGAATGTGATGAAATATGG + Intergenic
941460393 2:165764475-165764497 ATAATATATTTAATGAAATATGG + Intronic
941489917 2:166130618-166130640 ATGTTGTATCTTATGAAACATGG + Intergenic
942286775 2:174426265-174426287 TTTGTGTATTTGATGAAGTAGGG + Intronic
942940519 2:181609929-181609951 TTGGTGTATATTATGAAATAGGG - Intronic
943874953 2:193054795-193054817 ATTATATATTTGAAGAAAGAAGG + Intergenic
944138703 2:196430902-196430924 TTAATGTTTTTGATGAAATTTGG - Intronic
945170356 2:206989017-206989039 ATGATGTATTTCAAAGAATAAGG - Intergenic
948234922 2:236380259-236380281 GTGAAGCATTTGAGGAAATACGG - Intronic
1169687500 20:8291572-8291594 ATGATTTATTTGTTGATATTTGG + Intronic
1169708531 20:8534905-8534927 ATGATGCATTTGCTGATATAAGG - Intronic
1169981238 20:11386771-11386793 ATTTAGTATTTGATAAAATAAGG + Intergenic
1170181984 20:13541753-13541775 ATGATATATTTCATGAAGAAGGG + Intronic
1170223331 20:13964237-13964259 AAGATATATTTGACAAAATAGGG - Intronic
1171877410 20:30591241-30591263 TTTTTGTATTTGGTGAAATATGG - Intergenic
1172429637 20:34878689-34878711 ATTCTGTATTTGATGGAATTTGG - Intronic
1172496179 20:35386565-35386587 TTGATGTATGTGATGTAATGGGG - Intronic
1172530518 20:35627699-35627721 ATGATCCATTTGATACAATAAGG + Intronic
1175588347 20:60165652-60165674 ATGATGAATTTGGAGAAAAAAGG - Intergenic
1175602244 20:60284335-60284357 ATAATGTACTTGTTGAAACATGG + Intergenic
1177228658 21:18290081-18290103 TTGATGTATTTGCTGAAGTCTGG - Intronic
1179094241 21:38297673-38297695 AGGATATAATTGATGAACTAGGG - Intronic
1179323058 21:40311808-40311830 AGGATTTAATTCATGAAATAAGG - Intronic
1180310060 22:11214869-11214891 AATATGTATTTGATGTAATTTGG - Intergenic
1182955231 22:34418151-34418173 AGGATGGACTTGATGAAAGATGG + Intergenic
1184951582 22:47846533-47846555 ATCATGGAATTGATGAAATATGG + Intergenic
951196766 3:19832457-19832479 ATGATGTATATGATGAAAAATGG + Intergenic
951611760 3:24497507-24497529 AGGATGTCTATGGTGAAATATGG - Intergenic
953292689 3:41682205-41682227 TTGATGTATTTGATAAAACATGG - Intronic
955255977 3:57331874-57331896 ATGAGGAATTTGATCAGATATGG - Intronic
955730152 3:61976613-61976635 ATGAAGTATTTGTTTTAATATGG + Intronic
956431597 3:69191990-69192012 ATCTTAGATTTGATGAAATAAGG - Intronic
957439676 3:80228050-80228072 ATAATATATTTGATGCAAGAAGG + Intergenic
957703630 3:83751623-83751645 AAGAAGTATTTGAAGAAATTAGG + Intergenic
958564097 3:95785500-95785522 ATGATATATTTAAAGAAGTAGGG - Intergenic
958708073 3:97681722-97681744 ATGAAGTATTTTATTAAAAAAGG - Intronic
958898425 3:99856658-99856680 GTGATGTTTTTGAAAAAATAAGG - Intronic
959154024 3:102644230-102644252 AAGCTGTATTTGAAGAAGTATGG - Intergenic
959779813 3:110216995-110217017 AATATTTATTTAATGAAATATGG + Intergenic
960577251 3:119241354-119241376 ATAATATCTTTGAAGAAATACGG - Intergenic
961515646 3:127432279-127432301 TTGATCTATCTGTTGAAATATGG + Intergenic
962019672 3:131485376-131485398 ATTATGTATTTTATACAATATGG - Intronic
963201283 3:142588983-142589005 ATGATGTATTTATGAAAATAAGG - Intergenic
963341757 3:144044004-144044026 ATGCTGTATTTGAGGCAAGAAGG - Intronic
963640049 3:147849781-147849803 ATGATGTCTTTGAAGAAAACTGG + Intergenic
964217540 3:154303328-154303350 AAGATGTAATTGAAAAAATAAGG - Exonic
964237710 3:154552843-154552865 ATCTTATATTTAATGAAATATGG + Intergenic
965666450 3:171098947-171098969 ATTATGTATGTGAGAAAATAAGG - Intronic
965981369 3:174695828-174695850 ATGATTTATTGGATGATATTGGG - Intronic
966072962 3:175902075-175902097 ATGATTTATGTGACTAAATATGG - Intergenic
966534351 3:181015463-181015485 ATGATGGGTTTGCTGAAATGAGG + Intergenic
967137366 3:186523763-186523785 ATGATTGATGTGCTGAAATAGGG + Intergenic
967316955 3:188158715-188158737 AAAATGAATTTGGTGAAATAAGG + Intronic
967575400 3:191084647-191084669 TTGATGTACTTTATGAAATACGG + Intergenic
969287921 4:6218589-6218611 ATCTTGGAATTGATGAAATACGG + Intergenic
969944103 4:10765215-10765237 ATGATTTATTTGGGGAAATGGGG - Intergenic
970043882 4:11828043-11828065 ATGCTGTATGCCATGAAATAGGG + Intergenic
970232009 4:13920635-13920657 AAAATGTATTTGGTGAAATCGGG - Intergenic
970320723 4:14873028-14873050 AGGATGTATTTAGGGAAATATGG + Intergenic
970695267 4:18669462-18669484 ATTTTGTATTTTATGAAAAATGG + Intergenic
970791035 4:19858092-19858114 ATGAATTATTTCATGCAATATGG - Intergenic
971103200 4:23492969-23492991 AAAATATATTTTATGAAATAAGG - Intergenic
971145530 4:23971961-23971983 ATTATGTATTTGATTAAAAATGG - Intergenic
971296203 4:25395161-25395183 ATGAAGTATATTTTGAAATAAGG + Intronic
971936143 4:33150196-33150218 TTGATGTATTTCAAGAAACACGG - Intergenic
972016503 4:34252474-34252496 ATTTTGTATTTGATAAAATCAGG + Intergenic
972060014 4:34858045-34858067 ATGCTGTAATAGATTAAATATGG - Intergenic
972934257 4:44112910-44112932 ATGATGTATTTGATGTGCTGAGG - Intergenic
973093530 4:46167588-46167610 CTGATGACTTTGATGAAATAGGG + Intergenic
973148119 4:46855332-46855354 ATTATTTATTTGATTAAAAAAGG + Intronic
973693151 4:53461471-53461493 ACAATGGATTTGATGAAAAAAGG + Exonic
974393652 4:61306809-61306831 ATGATGAATTGACTGAAATAGGG - Intronic
974875930 4:67702583-67702605 ATGTTAGATTTGATAAAATATGG + Intergenic
975563760 4:75732519-75732541 ATAATGTTTTTAATGAAATAAGG - Intronic
976083542 4:81383459-81383481 ATCTTAGATTTGATGAAATATGG - Intergenic
976247376 4:83017243-83017265 ATGATTTATTTGAAAAAGTAAGG - Intergenic
976933290 4:90595883-90595905 ATGTTGTAATTGATTTAATATGG + Intronic
977058336 4:92221985-92222007 ATGATTTATGAGATAAAATACGG - Intergenic
977392389 4:96428294-96428316 ATGAATTATATGATGAAATTTGG - Intergenic
977575500 4:98669949-98669971 TTGATGAATTTGAAGAAACATGG - Intergenic
978334764 4:107654632-107654654 ATGATGTTTGTGCTGAAATGTGG - Intronic
978420089 4:108522783-108522805 ATGAAGTATAAGAGGAAATATGG - Intergenic
978907597 4:114026281-114026303 TTGATGTATTTGAAGAATTGTGG - Intergenic
979215069 4:118153454-118153476 ATAATGTATTTTATTACATAAGG - Intronic
980105796 4:128587194-128587216 ATGATGTGATTGTTCAAATAAGG + Intergenic
980438006 4:132804726-132804748 TCGATGTACTTGGTGAAATATGG + Intergenic
980719565 4:136676940-136676962 ATGATAAATTTGAACAAATAAGG - Intergenic
980785346 4:137547011-137547033 ATCATGTATTGTATGACATATGG + Intergenic
981423477 4:144577830-144577852 AAGATATTGTTGATGAAATATGG + Intergenic
982385703 4:154799586-154799608 ATGATGTATAATATGAAATTAGG + Intronic
982755650 4:159215651-159215673 ATGTTGTTTATGATTAAATATGG - Intronic
983342713 4:166485388-166485410 ATGATTTGTTTTATGAGATATGG + Intergenic
983761178 4:171408268-171408290 ATGAGTTATTTGATGATATGCGG - Intergenic
983856404 4:172651605-172651627 TTGTTATATATGATGAAATAAGG - Intronic
984356808 4:178670462-178670484 ATAATGTATATGAGCAAATAGGG + Intergenic
984692776 4:182746868-182746890 ATCATGTCATTGATAAAATAGGG + Intronic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
987435719 5:17891655-17891677 ATTATGCTTTTGATGAAAAATGG - Intergenic
987435876 5:17893773-17893795 AGGGTATATTTGGTGAAATAAGG + Intergenic
988008463 5:25450616-25450638 AAGATTTATTTGAGGCAATATGG - Intergenic
988120795 5:26958568-26958590 ATGATATATTTGACGAAAACTGG + Intronic
989442132 5:41485470-41485492 TTCATGTATTTGAAGAAAGAAGG + Intronic
990518875 5:56558192-56558214 ATGATGCGTTTTAGGAAATAGGG + Intronic
990802983 5:59626197-59626219 CTGAAGTATTTAATGAAATGAGG + Intronic
991393501 5:66176578-66176600 ATGGTGTATCTGATGAGATCGGG + Intronic
992297017 5:75336080-75336102 ATGATGTGTTTGAGGGAATTAGG + Intergenic
992485149 5:77187606-77187628 ATTTTAGATTTGATGAAATATGG + Intergenic
992786507 5:80175353-80175375 ATTATGGATTTTATGAATTAGGG - Intronic
993227436 5:85184861-85184883 ATGATTTAAATGTTGAAATATGG + Intergenic
993808795 5:92447667-92447689 ATGATGTTTTCTAGGAAATAGGG + Intergenic
994285897 5:97966575-97966597 ATTATGAATTGGATGAGATATGG - Intergenic
994509600 5:100687465-100687487 ATTATCTATTTTATGAAATCTGG + Intergenic
994512827 5:100727650-100727672 ATAATCTCTTTGATTAAATAGGG + Intergenic
994538890 5:101069175-101069197 ATTATGTGTTTGAGGTAATAAGG - Intergenic
994691028 5:103019669-103019691 ATAATGCATTTGATGAATTAAGG + Intronic
995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG + Intergenic
996089138 5:119333666-119333688 ATAATGTCTTTGTTGAAATCTGG + Intronic
998633148 5:143923355-143923377 ATGATCTTTGTAATGAAATATGG + Intergenic
999342825 5:150787818-150787840 ATCCTGTGTTTGAGGAAATAAGG + Intronic
1000601077 5:163275073-163275095 GTGACGAATTTGATTAAATATGG - Intergenic
1000798229 5:165692141-165692163 AAGATCAATTTAATGAAATAAGG - Intergenic
1000829987 5:166090968-166090990 ATGATGACTTTGATGATATATGG + Intergenic
1002112928 5:176932450-176932472 ATGACGTTTATGATGTAATACGG + Intronic
1002365771 5:178709473-178709495 ATCATGTATTAGAATAAATAAGG - Intergenic
1002438212 5:179246487-179246509 AGGAGATATTTGAGGAAATAAGG + Intronic
1003333852 6:5152412-5152434 ATGACGTACTAGATTAAATAGGG + Intronic
1004390591 6:15206349-15206371 ATGATTCATTTCATGAAAGAGGG - Intergenic
1004667703 6:17763772-17763794 ATCACAGATTTGATGAAATATGG + Exonic
1004703990 6:18106018-18106040 TTTATGTCTTTCATGAAATATGG - Intergenic
1004811280 6:19266571-19266593 ATGAAGTGTTTTATGAAAAAGGG + Intergenic
1005196125 6:23286398-23286420 ATGCTGGATTTGAGGAAACAAGG - Intergenic
1007344001 6:41214553-41214575 ATAATGTATGTGATGAAGGATGG - Intergenic
1008029306 6:46675402-46675424 ATGATGACATAGATGAAATAAGG - Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008830511 6:55754771-55754793 ATGATTTATTTGAGGTAAGAAGG + Exonic
1009005220 6:57777620-57777642 ATGATACATTTTGTGAAATATGG - Intergenic
1009287815 6:61844175-61844197 ATGATATATTTTGAGAAATATGG - Intronic
1009400627 6:63251171-63251193 ATGTTGTATTAAAAGAAATAAGG - Intergenic
1010274833 6:73957345-73957367 ATAATTTATATGATGAAATGAGG + Intergenic
1010417146 6:75625496-75625518 ATGATACATCTGATGACATAAGG - Intronic
1010665168 6:78620440-78620462 ATGATGTACTTGGTGAGAGAAGG - Intergenic
1010695517 6:78969048-78969070 AAGATGTGTTTCATCAAATAAGG - Intronic
1011043348 6:83055208-83055230 ATTATTTCTTTTATGAAATAAGG + Intronic
1014190035 6:118485110-118485132 ATGATATATTTCATGTAGTAGGG - Intronic
1015155806 6:130094899-130094921 GTGATGTATTTGGTGATTTAGGG + Intronic
1015389496 6:132665152-132665174 AAGATGTATTTGATGGAGCATGG + Intergenic
1015558304 6:134485448-134485470 GTGATGTATGTTATGAACTATGG + Intergenic
1015972437 6:138756089-138756111 ATGCTCTATTTTATGTAATAAGG + Intronic
1016271595 6:142296532-142296554 ATAATGTATCAGATGAACTACGG - Intergenic
1016865006 6:148757474-148757496 ATGATGTGATTTTTGAAATAGGG + Intronic
1016909301 6:149181484-149181506 ATGATGTAGTTAAAGAAATCAGG - Intergenic
1017487027 6:154912661-154912683 AAAGTGTATTTCATGAAATAAGG + Intronic
1017803802 6:157925198-157925220 ATCATGTACTTCATAAAATAAGG + Intronic
1018140835 6:160834034-160834056 ATGATGTATTTTTTTCAATATGG + Intergenic
1018347451 6:162916445-162916467 AAAATATATTTGAAGAAATAAGG - Intronic
1020851145 7:13354121-13354143 TTGATGTATTTGATTATATTAGG + Intergenic
1022352594 7:29579842-29579864 TGCATGTTTTTGATGAAATATGG + Intergenic
1022605400 7:31808761-31808783 ATGATGTTTAAGATGAAAAATGG + Intronic
1024421158 7:49168325-49168347 ATTAGGTAATTTATGAAATAAGG + Intergenic
1026324473 7:69296881-69296903 AAGATGTCCTTGATGATATATGG - Intergenic
1027350952 7:77310408-77310430 ATGAAGTATTTGACCAAAAAGGG + Intronic
1027417009 7:77984324-77984346 ATGATGTATTTTATAATATATGG - Intergenic
1027525965 7:79269021-79269043 ATGGTGGAGTTGATGAAAGAGGG + Intronic
1029470916 7:100753499-100753521 AGGGTGAATTTTATGAAATATGG - Intronic
1030554099 7:111001556-111001578 ATGATGAATATTATGAAATTTGG + Intronic
1030637092 7:111962756-111962778 ATGAAGTATTTCAAGAAAAATGG + Intronic
1031218464 7:118929699-118929721 TGGGTGTATTGGATGAAATAGGG + Intergenic
1031910863 7:127515541-127515563 ATGCTGCATTTGATGAAATAGGG - Intergenic
1032272978 7:130428557-130428579 GAGATGAGTTTGATGAAATATGG - Intronic
1034326659 7:150241475-150241497 ATGATCTATTTTATGAATGAAGG - Intergenic
1034766547 7:153727792-153727814 ATGATCTATTTTATGAATGAAGG + Intergenic
1035490879 7:159277148-159277170 ATAACTTATTTGAAGAAATAAGG - Intergenic
1035722555 8:1802924-1802946 ATTGTGTATTTGGTGAAAGAAGG + Intergenic
1036979221 8:13450052-13450074 ATGATTTATTTTACTAAATAAGG - Intronic
1037409115 8:18575966-18575988 ATCTTGTTTTTGATAAAATATGG - Intronic
1038057301 8:23872613-23872635 ATGATGTATGGTATGAAATAGGG + Intergenic
1038460610 8:27713540-27713562 ATAATCCATTTGATAAAATAGGG - Intergenic
1038574417 8:28692243-28692265 TTGATGGATTTGTAGAAATATGG + Intronic
1038827788 8:31024007-31024029 ATGAGATATTTGATATAATAAGG + Intronic
1039866337 8:41506776-41506798 ATGCTTTATTTGTTGAACTAGGG - Intronic
1040618130 8:49060897-49060919 ATGATGTAATTGATGAAGAAAGG + Intronic
1040675160 8:49740578-49740600 ATGATGTAGATGCTGAAACATGG + Intergenic
1040809412 8:51434988-51435010 TCCATGTATTTGATGAAATGTGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040871438 8:52103737-52103759 ATGCTGTGTTGGAGGAAATAGGG - Intergenic
1041058213 8:54009505-54009527 ATCATGTATTTGCAGAAACACGG + Intronic
1041646447 8:60257531-60257553 ATGATGTAGTTGGTGAATTTAGG - Intronic
1042677405 8:71337073-71337095 ATGCTGTAGATGATGTAATACGG + Intronic
1043653494 8:82631047-82631069 ACCATGTATTTTATAAAATATGG + Intergenic
1043733522 8:83715753-83715775 AATATGTTTTTTATGAAATAAGG + Intergenic
1043798943 8:84581933-84581955 CTGATGTATTTTATTACATAAGG + Intronic
1044111354 8:88279311-88279333 ATGTTTTATTTAATGCAATATGG - Intronic
1044648697 8:94471803-94471825 ATTTTAGATTTGATGAAATATGG - Intronic
1045362652 8:101447580-101447602 CTAATGTCTTTGATGAATTATGG - Intergenic
1045789577 8:105966656-105966678 ATAATGTATTTGACTTAATATGG + Intergenic
1045860417 8:106810464-106810486 ATGATTCATTTGGTGAAATTTGG - Intergenic
1046627825 8:116593912-116593934 ATAATTTATATGATGAAATGAGG - Intergenic
1046975242 8:120267853-120267875 ATGATAACTTTGGTGAAATAGGG + Intronic
1047549562 8:125855094-125855116 ATGATGTAGTTGAAGATATAAGG - Intergenic
1048226482 8:132592028-132592050 CTGGTGTATTTGATGAACTAAGG + Intronic
1048814668 8:138321236-138321258 ATTATATCTTTAATGAAATATGG - Intronic
1049893294 9:91006-91028 ATGATGTGTTTGATCACTTATGG - Intergenic
1051544870 9:18262543-18262565 ACAATTTATATGATGAAATATGG + Intergenic
1051679904 9:19596417-19596439 AGTATGTATGGGATGAAATAGGG + Intronic
1052297975 9:26919925-26919947 ATGAGGCATTTGATGAAAGGTGG + Intronic
1052439027 9:28468870-28468892 ATGATATTTTTGTTGAAATTTGG - Intronic
1053054806 9:34988068-34988090 ATGAGGAATTTGAGGAAATGGGG - Intergenic
1053525740 9:38828760-38828782 ATAAGGTATTTTATGAAATTAGG - Intergenic
1053734507 9:41091063-41091085 ATGATGTGTTTGATCATTTATGG - Intergenic
1053752249 9:41268536-41268558 TTTTTGTATTTGGTGAAATATGG + Intergenic
1054197973 9:62053196-62053218 ATAAGGTATTTTATGAAATTAGG - Intergenic
1054257775 9:62832868-62832890 TTTTTGTATTTGGTGAAATATGG + Intergenic
1054640383 9:67535175-67535197 ATAAGGTATTTTATGAAATTAGG + Intergenic
1054766450 9:69046442-69046464 TTGATGAATTTGAGGAAATCTGG + Exonic
1054838805 9:69712483-69712505 ATTATGTATTTTATGCAAAATGG + Intronic
1056153594 9:83813580-83813602 ATCATTTATTTTATGAGATACGG - Intronic
1056356897 9:85809517-85809539 ATCATTTATTTTATGAGATAGGG + Intergenic
1057363314 9:94395410-94395432 ATGATGTATTTGATAATAAGGGG + Intronic
1057539870 9:95956973-95956995 ATGATGTACATGATGAAACTGGG + Intronic
1057550523 9:96048496-96048518 AGCATGTATTTCATGAAATAAGG - Intergenic
1057660023 9:96992689-96992711 ATGATGTATTTGATAATAAGGGG - Intronic
1057947493 9:99342292-99342314 ATAATGGCTTTGATGAAACAGGG + Intergenic
1058265934 9:102898837-102898859 AAGATGTACTTACTGAAATAAGG + Intergenic
1058795703 9:108496364-108496386 ATTTTGTATTTGCTGAAATTGGG + Intergenic
1060611390 9:124968682-124968704 TTGATGAATTTGAGGAAATCGGG - Intronic
1202800988 9_KI270719v1_random:175475-175497 TTTTTGTATTTGGTGAAATATGG - Intergenic
1185660571 X:1725613-1725635 ATGATGTCTGTGATGACATTAGG - Intergenic
1187712031 X:22063980-22064002 ATTTTTGATTTGATGAAATATGG - Intronic
1187988407 X:24840981-24841003 ATGTTGTTTTGAATGAAATATGG + Intronic
1188568090 X:31549619-31549641 GTGATGTGTTTTATGAAAGAAGG - Intronic
1189530232 X:41872968-41872990 ATGAAGTATTTGATTATATGAGG - Intronic
1190591470 X:52006835-52006857 TTGAACTATTTGCTGAAATATGG + Intergenic
1191153642 X:57247225-57247247 ATAATGCATTGGAAGAAATAAGG + Intergenic
1193184341 X:78494690-78494712 ATCATGTATTTGATAAACAATGG - Intergenic
1194587140 X:95749411-95749433 ATGAAGTATTTGAATAAGTATGG - Intergenic
1195818928 X:108921029-108921051 ATAATAGAATTGATGAAATATGG + Intergenic
1196905271 X:120425139-120425161 TTGGTGTATTAAATGAAATAAGG + Intergenic
1197879235 X:131147447-131147469 ATCATGTATTTGAGGATACAGGG - Intergenic
1199412900 X:147545530-147545552 AAGATGCATTTGATGAAAAGGGG - Intergenic
1201668003 Y:16481156-16481178 AAGATGTATTGCATGAAATTTGG - Intergenic
1202341022 Y:23868294-23868316 ATGAAGAAATTGATGTAATAGGG + Intergenic
1202529744 Y:25801792-25801814 ATGAAGAAATTGATGTAATAGGG - Intergenic