ID: 1098078145

View in Genome Browser
Species Human (GRCh38)
Location 12:66755751-66755773
Sequence GTGAATTCCCTGACATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098078145_1098078157 23 Left 1098078145 12:66755751-66755773 CCTGGAAATGTCAGGGAATTCAC 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1098078157 12:66755797-66755819 TATGAGAATGGGGAGAGAGCAGG 0: 1
1: 0
2: 1
3: 29
4: 481
1098078145_1098078158 24 Left 1098078145 12:66755751-66755773 CCTGGAAATGTCAGGGAATTCAC 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1098078158 12:66755798-66755820 ATGAGAATGGGGAGAGAGCAGGG 0: 1
1: 0
2: 5
3: 71
4: 944
1098078145_1098078153 12 Left 1098078145 12:66755751-66755773 CCTGGAAATGTCAGGGAATTCAC 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1098078153 12:66755786-66755808 GAACTCTGCCCTATGAGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1098078145_1098078152 11 Left 1098078145 12:66755751-66755773 CCTGGAAATGTCAGGGAATTCAC 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1098078152 12:66755785-66755807 TGAACTCTGCCCTATGAGAATGG 0: 1
1: 0
2: 0
3: 12
4: 141
1098078145_1098078154 13 Left 1098078145 12:66755751-66755773 CCTGGAAATGTCAGGGAATTCAC 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1098078154 12:66755787-66755809 AACTCTGCCCTATGAGAATGGGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098078145 Original CRISPR GTGAATTCCCTGACATTTCC AGG (reversed) Intronic
900755065 1:4428955-4428977 GTAAATTCTTTGGCATTTCCTGG + Intergenic
902256236 1:15190514-15190536 GGGAATTCACTGGCTTTTCCTGG - Intronic
902673527 1:17992602-17992624 GTGAATCCCCTCACAGTCCCTGG - Intergenic
904585503 1:31577533-31577555 ATGGATGCACTGACATTTCCAGG + Intronic
906622354 1:47293243-47293265 GTGAATTCCTTGGTATTTCCAGG + Intronic
906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG + Intergenic
908820205 1:68078174-68078196 GTGAATTCTCTTAGCTTTCCTGG + Intergenic
909346303 1:74591452-74591474 GTAAACTCTCTGGCATTTCCAGG + Intronic
911743171 1:101410351-101410373 GTGAATTCTCTCAGATTTCCTGG - Intergenic
912942298 1:114056085-114056107 GTTAACTCCCGGGCATTTCCAGG + Intergenic
914621440 1:149413278-149413300 TTCAATTCCCAGGCATTTCCAGG - Intergenic
916331738 1:163625164-163625186 GTGGATTCGCTCAGATTTCCTGG + Intergenic
917240782 1:172946260-172946282 GTTAATTTCCTTCCATTTCCAGG + Intergenic
917566779 1:176220598-176220620 GATAATTCCCTGACATTGCCAGG - Intergenic
920706367 1:208253718-208253740 GTAACTTCTCTGCCATTTCCTGG - Intergenic
921179576 1:212621320-212621342 CTGAATTTCCTGGAATTTCCAGG + Intergenic
921633897 1:217468486-217468508 GTGCATTCCTTGACATTTTTTGG - Intronic
922073181 1:222216507-222216529 AAGAACTCCCTTACATTTCCAGG + Intergenic
922350537 1:224731620-224731642 GTGAAATCCCTCACAATGCCTGG - Intronic
923691904 1:236202466-236202488 GTGAATTCCTTCAGTTTTCCTGG + Intronic
924796923 1:247299465-247299487 GTGTATTCCCTGACAGTTCTGGG - Exonic
1063072726 10:2682255-2682277 GTGAAGTCACTGAGATTTCAAGG + Intergenic
1063341541 10:5269928-5269950 CTGAATACCATGAAATTTCCTGG + Intergenic
1064359325 10:14649357-14649379 GAGAATTCCCTTTCCTTTCCAGG + Intronic
1069223448 10:65911594-65911616 GCTGATGCCCTGACATTTCCTGG - Intergenic
1069936816 10:71923259-71923281 GTGAATTCCCAGGTACTTCCAGG + Intergenic
1071278483 10:84077712-84077734 CTCAACTCCCTGACACTTCCAGG + Intergenic
1071324295 10:84496743-84496765 GTGTGTTCCTTGTCATTTCCAGG + Intronic
1071409760 10:85377613-85377635 GTGAATTTCCAGACTTTTCTTGG - Intergenic
1071605576 10:86985187-86985209 ATGAATTCCTTGTCAATTCCGGG - Intergenic
1072483213 10:95829386-95829408 GTTAAGTCCCTGTCACTTCCAGG + Intronic
1075853766 10:125610125-125610147 GAGAATTCCCTGCCCCTTCCCGG + Intronic
1076311662 10:129512035-129512057 TTGAATTCACTGCCCTTTCCTGG - Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1079524096 11:21363489-21363511 GTGAATTCCTTCAGTTTTCCTGG + Intronic
1080809364 11:35687737-35687759 GAGAAAACCCTGACACTTCCAGG - Intronic
1081692824 11:45089586-45089608 CTGGATTCCCTGAAATTGCCTGG + Intergenic
1082734692 11:56843192-56843214 GAATATTCACTGACATTTCCGGG + Intergenic
1084735295 11:71101591-71101613 TTGAATTGCCTCACATTCCCGGG + Intronic
1085736418 11:79043030-79043052 GAGCATGCCATGACATTTCCTGG + Intronic
1085952115 11:81344609-81344631 ATGCATTCACTGACATTGCCAGG + Intergenic
1087395197 11:97588630-97588652 GTGAATTCTTTCACTTTTCCTGG - Intergenic
1088871599 11:113894775-113894797 GTGAACTCCCAGATATTTCCTGG - Intergenic
1092750979 12:11719037-11719059 GTGATTTCTCTGGCATCTCCAGG + Intronic
1093674292 12:21917540-21917562 ATGAATTCCATGATAATTCCAGG - Intronic
1095176240 12:39095544-39095566 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
1097607022 12:61768422-61768444 GTGAATTCTCTCAGCTTTCCTGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1098654824 12:73014303-73014325 GTGAATTCCTTCAGTTTTCCTGG + Intergenic
1099391498 12:82086080-82086102 TTGCTTTCCCTGACATTTCTAGG + Intergenic
1101988077 12:109462767-109462789 GTGAATTCCCTGATTTTTAAAGG + Intronic
1102815598 12:115863139-115863161 GAAAATATCCTGACATTTCCTGG + Intergenic
1104320234 12:127743793-127743815 GTGATTTAAATGACATTTCCTGG + Intergenic
1105666287 13:22560504-22560526 GTGTATTACCTGGCATTGCCAGG - Intergenic
1107560814 13:41555292-41555314 GTAAAGTACCTGACATTACCTGG - Intergenic
1107904232 13:45047483-45047505 GTGGAATCGCTAACATTTCCAGG - Intergenic
1108747624 13:53410753-53410775 AAGAATTCCCTGACCTCTCCAGG + Intergenic
1112306511 13:98279697-98279719 GTGATGTCCCTGACATCCCCTGG - Intronic
1112826641 13:103398998-103399020 GTGAAGTCTCTGACATGCCCTGG + Intergenic
1113901908 13:113802299-113802321 GTGATTTCCCTGTGGTTTCCCGG - Intronic
1114773232 14:25452701-25452723 CTAAATTCCCCCACATTTCCAGG - Intergenic
1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG + Intronic
1118891085 14:69909697-69909719 GAAAATACCCTGACATTTTCTGG - Intronic
1122423743 14:101593442-101593464 GTGAATTCCCTGAAGTCTCAGGG + Intergenic
1125108760 15:36005775-36005797 GTGAATGCCCTGACAGTCACTGG - Intergenic
1125247050 15:37652774-37652796 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
1125504132 15:40257209-40257231 TGGAATTCCCTGCCATTTGCGGG - Intronic
1125996808 15:44169563-44169585 GGAAATCCACTGACATTTCCTGG - Intronic
1129074077 15:72976480-72976502 ATCAATTCCTTGCCATTTCCCGG + Intergenic
1130640168 15:85665472-85665494 GAGAATCAACTGACATTTCCTGG - Intronic
1131853683 15:96569494-96569516 GTGAATACCCTCACATTACATGG + Intergenic
1135304683 16:21357861-21357883 TGGAATTCCCTGAAATTCCCTGG + Intergenic
1136301426 16:29336988-29337010 TGGAATTCCCTGAAATTCCCTGG + Intergenic
1138613216 16:58144127-58144149 AGCAATTCTCTGACATTTCCTGG + Intergenic
1139335050 16:66225825-66225847 GTGAATTCCCAGGCAGCTCCAGG + Intergenic
1140679021 16:77365699-77365721 GTTACTTCCCTGAGCTTTCCAGG - Intronic
1141239300 16:82250271-82250293 ATTCACTCCCTGACATTTCCAGG - Intergenic
1142063122 16:88043686-88043708 TGGAATTCCCTGAAATTCCCTGG + Intronic
1143796696 17:9342689-9342711 TTGATCTCCCTGTCATTTCCTGG - Intronic
1145904373 17:28508135-28508157 GAGAACTCCCTGGCATTCCCGGG - Intronic
1149093401 17:52812515-52812537 GTGAAGTCACTGATATTTCAGGG - Intergenic
1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG + Intronic
1155922019 18:31612968-31612990 GTGAATGACCTAACATTTCTAGG + Intergenic
1156992357 18:43424716-43424738 TTCAATTCCCTCACATTTCTAGG - Intergenic
1157152385 18:45231047-45231069 TTCTATTCCTTGACATTTCCAGG - Intronic
1157611872 18:48962193-48962215 GGTAATTTCCTGACATTACCTGG + Intergenic
1158653883 18:59311139-59311161 GTGAATTTCCTGAAACTCCCTGG - Intronic
1163223759 19:15940142-15940164 GTGAATTGTCTGACATTTAGCGG - Intergenic
1168458505 19:56534340-56534362 GAGAAGTTTCTGACATTTCCTGG - Intergenic
927198843 2:20566148-20566170 GTGAACTCCCTGTCAGTGCCGGG - Intronic
928720910 2:34119749-34119771 GTGAAATACCTGTCAATTCCTGG + Intergenic
929617905 2:43326811-43326833 GTGAATTCCCTCTCTCTTCCAGG - Intronic
931280486 2:60787023-60787045 GTGAATCCCCAGTCATTCCCAGG + Exonic
931637689 2:64355410-64355432 GAGATTTCAGTGACATTTCCAGG - Intergenic
933485719 2:82920927-82920949 GAAAATTCCCAGACATTTTCTGG - Intergenic
935146612 2:100399768-100399790 GTGAATTTCCTGGGATTCCCTGG + Intronic
938569206 2:132546733-132546755 GGGGATTCCTTGACAGTTCCGGG + Intronic
942183767 2:173404942-173404964 GAGGCTTCCCTGATATTTCCAGG + Intergenic
943607972 2:189998192-189998214 GTGAATTCTCTCAGTTTTCCTGG + Intronic
944990397 2:205229445-205229467 ATTAATTCCCTGAAATTACCAGG + Intronic
945729902 2:213520938-213520960 GTGACTTCCTTGACATTTTTGGG + Intronic
1168939583 20:1697253-1697275 GTGAATAGCATGACATCTCCAGG + Intergenic
1169448967 20:5695305-5695327 GTTAATTCCCTGATACTTTCAGG - Intergenic
1170724173 20:18911309-18911331 GAGAATTCCCTTTCCTTTCCAGG + Intergenic
1170869537 20:20192491-20192513 CTGAGTTCCCTGACATTTCAAGG + Intronic
1170962113 20:21034780-21034802 GTCACTTCCCTGACTTATCCAGG + Intergenic
1176289349 21:5035878-5035900 CAGAATCCCCTGACATTCCCAGG + Intronic
1177899343 21:26894572-26894594 GACAATTCCCTGAGATATCCTGG - Intergenic
1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG + Intergenic
1179799972 21:43806933-43806955 GCTAATTCCCTGATTTTTCCTGG - Intergenic
1179867880 21:44227709-44227731 CAGAATCCCCTGACATTCCCAGG - Intronic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
949829585 3:8199541-8199563 GTGAATTCACTGAGATTTTTTGG - Intergenic
950978826 3:17280065-17280087 TTTGATTCCCTGATATTTCCAGG - Intronic
952818893 3:37468825-37468847 GTGAATTCCCTCTCTTTTCTAGG + Intronic
953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG + Intergenic
953700887 3:45194937-45194959 GTGAATTCCGTGACACTTGGAGG + Intergenic
953718066 3:45332941-45332963 GTGAATTCCCTGGCTATGCCAGG - Intergenic
954954514 3:54507696-54507718 CTCCATTCCCAGACATTTCCAGG - Intronic
955939869 3:64137578-64137600 GTGGTCTCCCTGACATTTTCTGG - Intronic
956484720 3:69710251-69710273 GTGCATACACTGTCATTTCCTGG - Intergenic
957637904 3:82810646-82810668 GTTCATTCCCTGAAAATTCCAGG + Intergenic
957773774 3:84729027-84729049 GAGAATCCCCTTCCATTTCCAGG + Intergenic
958789006 3:98629861-98629883 GTTAATTACCTGACTTTTACTGG + Intergenic
959609408 3:108277270-108277292 GGGAATACCCAGACATTTCAAGG - Intergenic
960088357 3:113614261-113614283 GTGGATTCCCTGACTTTCCTTGG - Intronic
960744669 3:120873966-120873988 GAGAATCCCCTTACTTTTCCAGG - Intergenic
962182816 3:133226316-133226338 GAGAATTCCCTTGCCTTTCCAGG - Intronic
962406076 3:135101192-135101214 GAGAGTTCCATTACATTTCCAGG - Intronic
964017431 3:151964659-151964681 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
965065859 3:163847927-163847949 GTTTATTCCCAGAAATTTCCTGG - Intergenic
965813721 3:172615808-172615830 GTGAAATCACTGATATTTCATGG - Intergenic
966522183 3:180885775-180885797 GTAAATTCACTGCCATGTCCTGG - Intronic
969653747 4:8484029-8484051 GTTATTTCCTTGAGATTTCCAGG + Intronic
969862837 4:10051151-10051173 CTGAATCCCTTGGCATTTCCAGG - Intronic
970887821 4:21006972-21006994 GTGAATTTCCTGGCAGTGCCTGG + Intronic
971202620 4:24525435-24525457 GTTAATTTCCTGACATTTGCAGG + Intronic
971822313 4:31573819-31573841 CTTAATTCCCTGACATTTCGAGG + Intergenic
974164963 4:58190500-58190522 GTGGATTCTCTCACCTTTCCTGG - Intergenic
974570971 4:63648545-63648567 GTCAGCTCCCTTACATTTCCAGG - Intergenic
975771031 4:77722737-77722759 GTGAATTCACAGACATAACCTGG - Intronic
976696062 4:87920893-87920915 GAGAATCCCCTTCCATTTCCAGG + Intergenic
977553257 4:98464473-98464495 GTGACCTCCCTGCCAGTTCCCGG + Intergenic
978967428 4:114758033-114758055 CTGAATTCCCTAATAATTCCAGG + Intergenic
980156623 4:129115448-129115470 GTCAATTCCCTCAAACTTCCAGG - Exonic
980908782 4:138975270-138975292 GAGAATTCCCTTCCCTTTCCAGG + Intergenic
982415029 4:155120978-155121000 GAGAATTCCTTTCCATTTCCAGG + Intergenic
982566332 4:156991769-156991791 GTCAATTCCCTGGCACTTCTGGG - Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
984711084 4:182885796-182885818 GTGGATTTCTTGACCTTTCCAGG - Intergenic
985943702 5:3160219-3160241 TTGAATTCCATGGCATTTTCAGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989149250 5:38282511-38282533 GTTAATTCCCTGGCACTTCAAGG + Intronic
991002543 5:61796899-61796921 GTTAAGTCCCTGACATTTCAGGG - Intergenic
995073298 5:107950093-107950115 GTGAATTGCTGTACATTTCCAGG - Intronic
995801858 5:116005340-116005362 TTGAACTCCCTGGCATTGCCAGG - Intronic
998643813 5:144041070-144041092 TTGGGTTCCCTGAGATTTCCGGG - Intergenic
1000090663 5:157927094-157927116 ATCAAATTCCTGACATTTCCAGG - Intergenic
1001679204 5:173543918-173543940 GTCCATTCCTTGGCATTTCCAGG + Intergenic
1003428851 6:6020646-6020668 TTGAATTTCCTGTCATTTTCAGG - Intergenic
1004507234 6:16256876-16256898 CTGAATCCCTTGAGATTTCCTGG + Intronic
1012190051 6:96268179-96268201 CTAAATTTGCTGACATTTCCAGG - Intergenic
1012844500 6:104372746-104372768 GGGAATAACCAGACATTTCCAGG + Intergenic
1015347716 6:132179658-132179680 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
1015513756 6:134064682-134064704 GTGAATACCCTTCCATGTCCAGG - Intergenic
1015692505 6:135940528-135940550 CTGAACTCCCTGACAGTGCCTGG - Intronic
1019916371 7:4135341-4135363 GTGAATGCGCTCACCTTTCCTGG - Intronic
1020492920 7:8811470-8811492 GTTAATTCTCTGGAATTTCCAGG + Intergenic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1021751579 7:23806145-23806167 GTCAATGCCATGACATTTACTGG - Intronic
1021775243 7:24048070-24048092 GTGAAATCCCTTACATTGACGGG + Intergenic
1023108914 7:36790436-36790458 CTGAATCCAGTGACATTTCCTGG + Intergenic
1023861492 7:44219927-44219949 GGGAAGTCCCTGAGCTTTCCTGG - Intronic
1025005919 7:55354736-55354758 GGGAATCCCCTTCCATTTCCAGG + Intergenic
1025914717 7:65856460-65856482 ATGTATTCCCTGTGATTTCCAGG + Intergenic
1026918046 7:74134466-74134488 GGGAAATCCCTGCCCTTTCCTGG + Intergenic
1027139555 7:75647633-75647655 GTGAATTGCCTGAGAGCTCCGGG - Intronic
1027977547 7:85178770-85178792 GTGAAGTCTCTGACATGCCCTGG - Intronic
1029866615 7:103638227-103638249 GTGATTTTCCTGACATTACAGGG - Intronic
1031643850 7:124199302-124199324 GTAACTTCCCTGGCATTTCTAGG - Intergenic
1032674280 7:134114128-134114150 GAGAATCCCCTTCCATTTCCAGG + Intergenic
1034509677 7:151523524-151523546 GTGAATTCCCTGAATTTCACTGG + Intergenic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1037452069 8:19025513-19025535 GTGAATTCCTTGACTTGTCCAGG + Intronic
1037586102 8:20277260-20277282 GGTAATTTCCTGACATTGCCAGG - Intronic
1038012440 8:23485946-23485968 GTGAATTCCCTGAAACTCCCAGG + Intergenic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1041431561 8:57786894-57786916 GTGATTTTTCTGAAATTTCCAGG + Intergenic
1043361648 8:79479461-79479483 GTCAATTCCTACACATTTCCTGG + Intergenic
1048371827 8:133785008-133785030 GTGAATTCTTTGAGTTTTCCTGG + Intergenic
1048511192 8:135064267-135064289 ATGAACTCCCAGATATTTCCAGG + Intergenic
1048805558 8:138237966-138237988 GTGATATCCCTGACACTGCCTGG - Intronic
1049959926 9:728563-728585 GTGAATCCCCTTACCTGTCCAGG + Intronic
1051540054 9:18205665-18205687 GTGAATTCATTCATATTTCCTGG + Intergenic
1056727730 9:89136510-89136532 GGTAACTTCCTGACATTTCCTGG - Intronic
1058968271 9:110057016-110057038 GGGAATTCCCTGTAATTCCCAGG + Intronic
1059992904 9:119882017-119882039 GTGGATTCCCTTAGGTTTCCTGG - Intergenic
1061635624 9:131906944-131906966 GTTAACTTCCTGACATTGCCAGG + Intronic
1062174669 9:135154559-135154581 GGGATTTCTCTGACCTTTCCAGG - Intergenic
1187550129 X:20294015-20294037 GTGAATCCCCTGATATTGCAAGG - Intergenic
1188323642 X:28772511-28772533 CTAAATACCCTCACATTTCCTGG - Intronic
1188546696 X:31315113-31315135 GTGAATTCCCAAACATTCCCGGG - Intronic
1189264364 X:39702390-39702412 GGGACTTCCCTGACATTTCCTGG - Intergenic
1189946118 X:46180564-46180586 GTGAATTCTCTCAGCTTTCCTGG + Intergenic
1191884141 X:65872371-65872393 GTGAATTCTCTCAGTTTTCCTGG + Intergenic
1192195167 X:69023090-69023112 GAGATTTCCCTTAGATTTCCTGG + Intergenic
1192317422 X:70063589-70063611 GAGATTTCCCTCATATTTCCGGG - Exonic
1193196883 X:78643220-78643242 GTGGATTCCCTCAGCTTTCCTGG - Intergenic
1195292128 X:103439446-103439468 GAGAATTCCCTATCCTTTCCAGG - Intergenic
1197545138 X:127815424-127815446 GTGAATTCTCTCAGTTTTCCTGG - Intergenic
1199670189 X:150139422-150139444 GTGAATTCCATTACATTTTAAGG - Intergenic
1201148302 Y:11079055-11079077 GAGAATCCCCTTACCTTTCCAGG + Intergenic
1201782849 Y:17742511-17742533 GTGAATTCCCATACATGTCTTGG - Intergenic
1201818704 Y:18163476-18163498 GTGAATTCCCATACATGTCTTGG + Intergenic
1202032040 Y:20586445-20586467 GAGAATTTCCTGGCAGTTCCCGG - Intronic