ID: 1098081232

View in Genome Browser
Species Human (GRCh38)
Location 12:66787626-66787648
Sequence CTTACATGACAGAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 6, 3: 96, 4: 654}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098081232_1098081235 -8 Left 1098081232 12:66787626-66787648 CCTTGTTCCTTCTGTCATGTAAG 0: 1
1: 0
2: 6
3: 96
4: 654
Right 1098081235 12:66787641-66787663 CATGTAAGGACACAGCTAGAAGG 0: 9
1: 100
2: 599
3: 1663
4: 2862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098081232 Original CRISPR CTTACATGACAGAAGGAACA AGG (reversed) Intronic
900320992 1:2083815-2083837 CTTACATGTCAGTTGAAACATGG + Intronic
900508528 1:3043842-3043864 CTTTCATGAAAGAAGGTCCATGG - Intergenic
904490240 1:30854138-30854160 TTAACAAGACAGAAGGAACTTGG - Intergenic
904976495 1:34460905-34460927 CTTCCTAGGCAGAAGGAACAAGG + Intergenic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
906055620 1:42914473-42914495 CTTACAGGACAGAAGGGAGTGGG + Intergenic
906068707 1:43001804-43001826 CTTACATGGTAGAAGGGGCAAGG + Intergenic
906560943 1:46756347-46756369 TTTACATGCCAAAAGGAATAAGG - Intergenic
906887172 1:49661530-49661552 CTTACATGGCAGAAGGCAAAGGG - Intronic
907715022 1:56918543-56918565 CTTACATGGCAGAAGGGGCTAGG + Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907887235 1:58604579-58604601 CTTACAAGTCAGAAGCAACTGGG - Intergenic
907908627 1:58807949-58807971 CTTTCATAACAGAAAGAATATGG + Intergenic
908004815 1:59717070-59717092 CCTACATCACAGAATGGACAAGG - Intronic
908112466 1:60910847-60910869 CTTACATGGCAGAAGGCGAAGGG - Intronic
908713261 1:67041965-67041987 CTTACATGCCAGAAGGATAGAGG - Intronic
908900818 1:68954534-68954556 CTTACATGGTAGAAGAAGCAAGG + Intergenic
909107694 1:71433115-71433137 CTCACATGGCAGAAGGCAGAAGG - Intronic
909878834 1:80847472-80847494 CTCACATGGCAGAAGGCAGAAGG + Intergenic
909894192 1:81045842-81045864 CCTACATGAGAGACGGAGCAAGG - Intergenic
910236258 1:85039383-85039405 CTTACATGATGGAAGGCAGAAGG - Intronic
911026062 1:93436162-93436184 CTTATATGACAAAAGGTACTTGG - Intergenic
911048832 1:93652159-93652181 CTTTCAGAACAGAATGAACAAGG - Intronic
911740545 1:101382460-101382482 CTTACATGGCAAAAGGGACTTGG - Intergenic
911969520 1:104414096-104414118 TTTACATGAAAGAAGATACATGG + Intergenic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912397612 1:109359208-109359230 CGTACATGACAGAAGGGGCAAGG + Intronic
912941446 1:114048728-114048750 CTTACATGGAAGAAGGCAGACGG + Intergenic
913663268 1:121023469-121023491 CTTACAAGTCAGAAGAAACTGGG + Intergenic
914014654 1:143806734-143806756 CTTACAAGTCAGAAGAAACTGGG + Intergenic
914163166 1:145154467-145154489 CTTACAAGTCAGAAGAAACTGGG - Intergenic
914384157 1:147151381-147151403 CTTACATGGTAGAAGGCAGAGGG + Intergenic
914395309 1:147261334-147261356 CTCACATGACAGAAGGTGGACGG + Intronic
914653278 1:149715291-149715313 CTTACAAGTCAGAAGAAACTGGG + Intergenic
915970401 1:160351148-160351170 CTTACATCCCAGAAGGAGGAGGG - Intronic
916264487 1:162876968-162876990 CTCACATGACAGAAGGGAGGAGG - Intergenic
916358215 1:163936988-163937010 CTTACATGGCAAAAGAAACTTGG - Intergenic
917005032 1:170405620-170405642 CTCACATGACAGAAGGGGTAAGG - Intergenic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917246990 1:173014162-173014184 CTCACATGGCAGAAGGCAGAAGG - Intergenic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
918847355 1:189634593-189634615 CTTACATGGCAGCAGGCAAAAGG + Intergenic
919588490 1:199469469-199469491 CTCACATGACAGAGGGCAAATGG + Intergenic
920294071 1:204945288-204945310 GTTCCTTGACACAAGGAACAGGG - Intronic
920744054 1:208608804-208608826 CTTACATGGCTGAAGGAAGAAGG + Intergenic
921225120 1:213011208-213011230 CTTCCATATCAGGAGGAACAAGG + Intronic
921270145 1:213460917-213460939 CTTACATGCCAGAAGGGAGTGGG - Intergenic
921326907 1:213994507-213994529 GTCAGATGACAGAAAGAACAAGG - Intronic
922466698 1:225849433-225849455 CTTCCATGCCAGGAGGTACAAGG + Intronic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
923170393 1:231411260-231411282 CTTACGTGACAGAAGGAGGCGGG - Intronic
923291935 1:232553922-232553944 CTTAAATGAAAGAATGAACATGG - Intronic
923730406 1:236544377-236544399 CTTTCAAGAAGGAAGGAACACGG + Intronic
923810805 1:237313294-237313316 CTTATATGACAAAAGGGACTTGG + Intronic
923910263 1:238433333-238433355 CTTACAAGCCAGAAGGAATGGGG + Intergenic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924433341 1:244016508-244016530 CTCACATGGCAGAAAGAAAAGGG - Intergenic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
1063008300 10:1996009-1996031 CTTACATGGCAGCAGGAGCGAGG - Intergenic
1063722689 10:8599986-8600008 CTTACATGACACAGGCAAGAGGG + Intergenic
1063918618 10:10909514-10909536 CTACCAGGGCAGAAGGAACACGG - Intergenic
1063985863 10:11501113-11501135 CTAAAATGAAAGAAGAAACAAGG - Exonic
1064426094 10:15230940-15230962 ATTACATGTCAGAAGGGACTGGG + Intronic
1064478407 10:15716099-15716121 GGTCCATGACAGAATGAACAAGG - Intronic
1064573977 10:16725617-16725639 CTCCCATGACAGAAGGCAGAAGG - Intronic
1065460344 10:25956077-25956099 CTCACATGGCAGAAGGCAGAAGG + Intronic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1066072540 10:31834384-31834406 CTCACATGGCAGAAATAACAAGG - Intronic
1066136296 10:32449853-32449875 CTCACATGATGGAAGGAGCAAGG - Intronic
1066470648 10:35694463-35694485 TTTAGATGAGAGAAGGAAGAAGG - Intergenic
1066680105 10:37929944-37929966 CTCACATGATAGAAGGGGCAAGG + Intergenic
1066999373 10:42592885-42592907 TTTACATGAGAGAAAGCACACGG - Exonic
1067395282 10:45910265-45910287 CTGAGAGGACAGAAAGAACATGG + Intergenic
1067863604 10:49879389-49879411 CTGAGAGGACAGAAAGAACATGG + Intronic
1068234150 10:54210662-54210684 CTTAGATGTCAGAAAGAGCATGG + Intronic
1068804082 10:61174972-61174994 CTCAGATGACAGAAGGCAGAAGG + Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1070311891 10:75279853-75279875 CTCACATGGCAGAAGGCACAAGG + Intergenic
1070487108 10:76941907-76941929 CTCACATGACAGAAGGGACGAGG + Intronic
1071188718 10:83076251-83076273 ATTACATAACAGATGGGACATGG + Intergenic
1071297075 10:84229190-84229212 CTTACATGACATCAGGCAAAAGG + Intergenic
1071580344 10:86763421-86763443 CTTAAAAAATAGAAGGAACATGG + Intronic
1072597890 10:96892525-96892547 CTCACATGACAAAAGGATGAGGG + Intronic
1072791927 10:98324403-98324425 TTTAGATTACAGAATGAACATGG + Intergenic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073604052 10:104875914-104875936 CTCACATGGCAAAAGGAAAATGG + Intronic
1073877946 10:107947475-107947497 CTTGCATGAAAGAAGGCAGAAGG + Intergenic
1073952064 10:108821314-108821336 TTTACATGACAGAAGGCAGAGGG - Intergenic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074252264 10:111762839-111762861 CTCACATGACAGAAGACAGAAGG - Intergenic
1074836470 10:117300782-117300804 CTCACATGGCAGAAGGGATAAGG - Intronic
1075196398 10:120363003-120363025 CTTATCTGGTAGAAGGAACAAGG - Intergenic
1075350960 10:121724988-121725010 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1075436371 10:122446221-122446243 CCTACATGACAGCAGGACCTTGG - Intergenic
1076117391 10:127909641-127909663 CATACATTTCAGAAGCAACATGG - Intronic
1076600698 10:131655143-131655165 CTTCCATGACCTAAGGAACGTGG - Intergenic
1077821191 11:5742537-5742559 CTTACAAGCCAGAAGGGACTGGG + Intronic
1077956618 11:7027407-7027429 CTCACATGGCAGAAGGAACCAGG + Intronic
1078411781 11:11128098-11128120 CTTACAAGCCAGAAGGGACTGGG - Intergenic
1078615205 11:12858633-12858655 CATAGATGAAAGAAAGAACATGG + Intronic
1078642761 11:13111699-13111721 TTTACATGACAGAAGGAAAGGGG - Intergenic
1078711051 11:13791493-13791515 CTCACATGCTGGAAGGAACAAGG - Intergenic
1079481118 11:20881120-20881142 CTTACTTATCAGAAGGAAAAGGG - Intronic
1079585730 11:22124927-22124949 CTTGCAGGCCAGAAGGAAAAGGG + Intergenic
1079651385 11:22934317-22934339 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1080024157 11:27596269-27596291 CTCATGTGGCAGAAGGAACAAGG - Intergenic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1081059403 11:38454616-38454638 CTTACATGGCAGCAGGCACAGGG + Intergenic
1081111191 11:39136070-39136092 CTTATAAGCCAGAAGGAACTGGG - Intergenic
1081196267 11:40164619-40164641 CTTACATATTAGAAAGAACATGG - Intronic
1081324676 11:41729481-41729503 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1081362187 11:42193685-42193707 CTTACATGGCATAAGGGACTTGG - Intergenic
1081429732 11:42963271-42963293 CTTACAAGACAGAGAGAAAATGG + Intergenic
1081451984 11:43179800-43179822 CTTACATCAAGGAAGGAGCATGG - Intergenic
1081660979 11:44888224-44888246 CTCAGATGCCAGAAGGCACATGG - Intronic
1081782813 11:45724928-45724950 TTTTCATGACAGAAGGAAAAAGG + Intergenic
1082782545 11:57299045-57299067 CATACATGGTAGAAGGGACAAGG - Intergenic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1085157903 11:74312673-74312695 CTTTCCTGGCAGAAGGTACATGG + Intergenic
1086394078 11:86396291-86396313 TTTACATGAATGAAGCAACATGG + Intronic
1087088354 11:94242663-94242685 CCCACAGGACAGAGGGAACATGG - Intergenic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1088136945 11:106567499-106567521 CTTACATGGCAGCAGGTAAAAGG + Intergenic
1088176145 11:107054770-107054792 CTTACAAGCCAGAAGGGACTGGG + Intergenic
1088338552 11:108736703-108736725 CTCACATGGCAGAAGGCAGAGGG - Intronic
1088416450 11:109594600-109594622 CTCACATGACAGAAGGCAGAAGG + Intergenic
1088525819 11:110753159-110753181 CTTACAAGCCAGAAGGGACTGGG - Intergenic
1089019220 11:115194829-115194851 CACACAGGGCAGAAGGAACAAGG + Intronic
1089238748 11:117055847-117055869 CTCACATGGCAGAAGGCAGAAGG - Intronic
1089852856 11:121515402-121515424 ATTACATGAGGGAAGGAACCAGG + Intronic
1090368692 11:126230000-126230022 CTTATCTGACAGAAGGTAGAGGG + Intronic
1090886101 11:130878199-130878221 CCAACATCACAAAAGGAACAGGG + Exonic
1090987004 11:131776782-131776804 GTCACAGGACAGAAGGAACCTGG - Intronic
1090991861 11:131824914-131824936 CTGACAGAGCAGAAGGAACACGG + Intronic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1093266806 12:17013764-17013786 CTTACAAGCCAGAAGGGACTAGG - Intergenic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1094175173 12:27533957-27533979 CTGACCTGACAGCAGGACCAGGG - Intronic
1094628108 12:32145236-32145258 CATACATCACAGAAGTCACAGGG + Intronic
1094741121 12:33290484-33290506 CTTAGAGGACAGAAGCAAGATGG - Intergenic
1095343146 12:41116543-41116565 TTCACATGGCAGAAGGAACCAGG - Intergenic
1097461953 12:59872993-59873015 CTTACATGGCAGCAGGAGAAAGG - Intergenic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1098108866 12:67100712-67100734 AATACAGGACAGTAGGAACATGG - Intergenic
1099754536 12:86826978-86827000 CTAACATAACAGAAATAACATGG + Intronic
1099757126 12:86866008-86866030 AATACATGACAGAAATAACAGGG - Intergenic
1100335264 12:93623249-93623271 CTTACATGGCAGCAGGAGAAAGG - Intergenic
1100714100 12:97288008-97288030 CATACATGACAGAAGTAGAACGG - Intergenic
1100779689 12:98010681-98010703 CTCACATCAAGGAAGGAACAAGG - Intergenic
1100943052 12:99745762-99745784 CTTATATGACAAATGAAACATGG - Intronic
1101317257 12:103640756-103640778 CTCACATGATAGAAAGAAGATGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1102266100 12:111486756-111486778 CCTACCTGAGAGAAGGAACGTGG + Exonic
1104127065 12:125857963-125857985 CAAACATGACAGAAGGCAAAAGG - Intergenic
1105939671 13:25136304-25136326 CTTAAAGGACAGAAGCAATAAGG + Intergenic
1106648646 13:31665129-31665151 CTTACACGACAGAAGGCAAAGGG + Intergenic
1106894831 13:34288798-34288820 CCTAAATGACAGGAGGAGCAAGG + Intergenic
1106900216 13:34347842-34347864 CTTACAAAACAGAAAGCACATGG - Intergenic
1107360564 13:39613261-39613283 CTCACATGGCAGAAGGAGCGAGG + Intergenic
1107799301 13:44089235-44089257 TTCACATGGCAGAAGAAACAGGG - Intergenic
1108049005 13:46411098-46411120 CTTACAAGACAGAAGCAATTTGG + Intronic
1108743360 13:53362297-53362319 CTTCAATGAAAGAAGGAAGATGG - Intergenic
1108910315 13:55541984-55542006 CTCACATGACAGAAGGTGCCAGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109330008 13:60917917-60917939 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1109330231 13:60919919-60919941 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1109413503 13:62005652-62005674 CTCACATGGCAGAAGGCAAAAGG - Intergenic
1109541534 13:63784445-63784467 CTTACAAGACAGAAGCAATTTGG + Intergenic
1109810213 13:67503555-67503577 TTTACATGACAGAAAGAAATTGG - Intergenic
1109988391 13:70019998-70020020 CTCACGTGACAGAAGGCAGAAGG - Intronic
1110538658 13:76682374-76682396 CTTACATGAGAGGAGGGGCAGGG - Intergenic
1110662320 13:78071748-78071770 CTGACATGACAGAAAGGACATGG - Intergenic
1110888051 13:80663580-80663602 CTTACAGGCCAGAAGGAAGTGGG - Intergenic
1110890024 13:80687918-80687940 CTTACATGGCAGGAGCAAGAGGG + Intergenic
1111641484 13:90976279-90976301 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1112104111 13:96221703-96221725 CTCATATATCAGAAGGAACAAGG + Intronic
1112698878 13:101981315-101981337 CTTACATGGCGGAAGGGGCAAGG - Intronic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1113140512 13:107143580-107143602 TTTACATGACGGTAGGAACAAGG + Intergenic
1113537618 13:111080816-111080838 CTTGCAGGGCAGGAGGAACAAGG - Intergenic
1114084300 14:19228198-19228220 CTCACATGACAGAAGGGATGAGG - Intergenic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1115452872 14:33568708-33568730 GTTTCATGACAGAAGTAACATGG + Intronic
1116145977 14:41069550-41069572 CTCACAGGACAGAAGGTAGAAGG - Intergenic
1116425492 14:44785096-44785118 CTTGCATGGCAGAAGGGGCAAGG - Intergenic
1116429436 14:44828903-44828925 CTCACATGACAGAAAGGGCAAGG - Intergenic
1117241678 14:53839898-53839920 ATTCCATGACAGAAGGCAGAAGG + Intergenic
1117733078 14:58743474-58743496 CTCACATGGCAGAAGGCTCAAGG - Intergenic
1118070677 14:62243870-62243892 CTTACATAGCAGAAGGGACCTGG + Intergenic
1118702097 14:68443407-68443429 CTTCCAGGGCAGAAGGAACCTGG + Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1119167308 14:72505376-72505398 TTCACATGACAGAAGGGAAAGGG + Intronic
1119609134 14:76047009-76047031 CTCACATGGCAGAAGGCAGAAGG + Intronic
1119705974 14:76782777-76782799 CTGACAAGAGAGAAGAAACATGG + Exonic
1119927483 14:78509425-78509447 CTTACATGAGATCAGGAAAATGG + Intronic
1120413158 14:84184067-84184089 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1121138420 14:91519579-91519601 GTCACATGACAGAAAGAATATGG + Intergenic
1121424241 14:93837107-93837129 CTCACATGGCAGCAGGAGCAAGG + Intergenic
1121915400 14:97833158-97833180 CTCACATCACAGGAGGAAAAGGG - Intergenic
1202895914 14_GL000194v1_random:10060-10082 CTCACATGACAGAAGGGATGAGG - Intergenic
1124089258 15:26582415-26582437 CTTAGAGGACAGAAGGCTCAGGG - Intronic
1124467666 15:29953110-29953132 CTTTTATGAAAGAAGGAAGAGGG - Intronic
1124618124 15:31257126-31257148 CTTACATAGTAGAAGGGACAAGG - Intergenic
1124839542 15:33229021-33229043 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126401300 15:48273446-48273468 CTTACATGGCAAAAGGGACTTGG - Intronic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127040064 15:54965080-54965102 CTTTCATGACACAAAGAACCTGG + Intergenic
1127040135 15:54966158-54966180 TTCACATGATAGAAGGAGCAAGG + Intergenic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127525639 15:59790108-59790130 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1128320204 15:66688122-66688144 CTTACTTGACAGAAGGTGGAGGG + Intergenic
1128591788 15:68904493-68904515 CTCACATGGCAGAAGGCAGAAGG + Intronic
1128984535 15:72209598-72209620 CTTCCTTGACACAAGGAAGATGG - Intronic
1129186704 15:73911699-73911721 CTAACAGGAAAGGAGGAACACGG - Intergenic
1129552224 15:76465288-76465310 CTCACCTGACAGAAGGGGCAAGG + Intronic
1131100698 15:89687599-89687621 CTTACAAGACAGTAGGAACCAGG - Intronic
1131193645 15:90337423-90337445 CTTACGTGACATGAGGAACCTGG + Intergenic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1131560743 15:93437243-93437265 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1132020547 15:98358148-98358170 CTCACATGACAGAAGAAGCAAGG - Intergenic
1134829495 16:17311822-17311844 CTTACATGGCAGCAGGCAAAAGG + Intronic
1135037783 16:19092641-19092663 CTTATAGGTCAGAAGGACCATGG + Intergenic
1135178632 16:20253633-20253655 CTCACATGACAGAAGAGGCAAGG + Intergenic
1135878144 16:26224843-26224865 CATAAAAGACAGAGGGAACATGG + Intergenic
1137018888 16:35402905-35402927 CCTCCATGACAGAAGGGACAAGG - Intergenic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1137384233 16:48026801-48026823 CTTACATGGCAGAAGGCAGAAGG + Intergenic
1138317491 16:56082687-56082709 CTTACATGGTGGAAGGAAAAAGG + Intergenic
1138397162 16:56713867-56713889 CTCACATGGCAGAAGGCAGAAGG + Intronic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139180917 16:64747621-64747643 CTTACATGACAGCAGCTAGATGG + Intergenic
1139401827 16:66688118-66688140 CTCACATGGCAGAATGAGCAAGG + Intronic
1139523782 16:67500638-67500660 CTGGCATGACTAAAGGAACAGGG + Intergenic
1141030037 16:80579627-80579649 CTCACATGATGGAAGGAGCAGGG - Intergenic
1141042422 16:80683774-80683796 CTCACATGATAGAAGGGGCAAGG - Intronic
1141117528 16:81323148-81323170 CTTACATGAAAGTTGGTACAGGG + Intronic
1141373766 16:83510947-83510969 CTTACATGACAGAATAGGCATGG - Intronic
1143428495 17:6861095-6861117 CCTACAAGCCAGAAGGCACAGGG - Intergenic
1143456122 17:7069193-7069215 CTACCATGACAGAAGTACCAAGG + Intergenic
1143975048 17:10823437-10823459 CTCACAATGCAGAAGGAACAAGG + Exonic
1144226951 17:13158459-13158481 CTCACATGACAGAAGGCAAAAGG + Intergenic
1144312547 17:14026140-14026162 TTTACATGACAGAAGGGATGAGG + Intergenic
1144332208 17:14235185-14235207 TTTACATGACAGAAGGGATGAGG - Intergenic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1146599038 17:34196774-34196796 CTTTCAGGAAAGAAAGAACAAGG + Intergenic
1147427053 17:40350926-40350948 TTTTCATGGCAGAAGGACCAGGG + Intronic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1148943209 17:51234087-51234109 CATAAATGAAAGAAGTAACAAGG + Intronic
1149410733 17:56403992-56404014 CCTACAAGCCAGAAGGAATAGGG - Intronic
1149580061 17:57743509-57743531 ATTCTATGACAGAAGGAAGAGGG + Intergenic
1149810047 17:59659766-59659788 CTAACATAATACAAGGAACATGG - Intronic
1150325221 17:64251602-64251624 CTGACATGTCAAAAGGAAAAAGG - Intronic
1150515901 17:65808972-65808994 ATAACATGGCAGAAGGCACATGG - Intronic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1150828136 17:68494683-68494705 CTTACATTACAGAAGTCTCAGGG - Intergenic
1150998551 17:70347522-70347544 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1152145486 17:78566035-78566057 CTTACATGGCAGAAGGGGCAAGG - Intronic
1152189319 17:78878896-78878918 ATTACATGAAAGAAGGAAAATGG + Intronic
1152305617 17:79518722-79518744 CTTCCCTAACAGAAGCAACACGG + Intergenic
1153132861 18:1877382-1877404 CTCACATGACAGAAGGGGGAAGG - Intergenic
1153425210 18:4955195-4955217 CTTACAAGCCAGAAGGAACTGGG + Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153967643 18:10196191-10196213 CTCACGTGGCAGAAGGAGCAAGG + Intergenic
1156470497 18:37374709-37374731 CTTCCATGGGAGAAGGAACCGGG - Intronic
1156708300 18:39911020-39911042 CTCACATGATAGAAAGAGCAAGG - Intergenic
1157007146 18:43596634-43596656 CTGACATGAAAGAAAGAGCAGGG - Intergenic
1157679707 18:49595137-49595159 CTTACATGGCAGAGGGCTCAGGG - Exonic
1158299597 18:56036443-56036465 GTCTCATGGCAGAAGGAACATGG + Intergenic
1158943456 18:62427485-62427507 CTTAGATGAGAGAAGAAAGAAGG - Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1160253785 18:77229278-77229300 CTAACATCACAGAATGAAAATGG + Intergenic
1160689787 19:456260-456282 CCTACATCACAGCAGGCACAGGG - Intronic
1161182892 19:2897133-2897155 CATACATGCCAGAATGCACACGG - Intergenic
1162656713 19:12136842-12136864 CTCACTTACCAGAAGGAACAGGG + Intronic
1163338024 19:16686383-16686405 CTTACAGGACACCATGAACAAGG - Exonic
1164248879 19:23459442-23459464 CTTCCCTGACAGAAGGGACCAGG - Intergenic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165642007 19:37397695-37397717 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1165642252 19:37399681-37399703 CTCACATGGCAGAAGGCAAAAGG + Intergenic
1166653545 19:44593735-44593757 CTTACATGGCAGAAGGGATGAGG - Intergenic
1167768108 19:51497547-51497569 CTTCCCGGACAGAAAGAACAAGG + Intronic
1168637241 19:58005889-58005911 CTCACCTGACAGAAGGTAAAGGG - Exonic
925174086 2:1770243-1770265 CTTTCTTGACAGAAGAAACTGGG - Intergenic
925880641 2:8349611-8349633 CTCACATGGCAGAAGGCAGAGGG + Intergenic
926318977 2:11734950-11734972 TTGACGAGACAGAAGGAACAAGG + Intronic
926672246 2:15587422-15587444 CTTACATGGCAGGAGGTACAAGG - Intergenic
927225625 2:20763288-20763310 CTGACATCACAGAAAGACCAAGG + Intronic
927321926 2:21757162-21757184 CTCACATGACTGAAGGAGCGAGG + Intergenic
928044700 2:27917512-27917534 CTTGCATGGCAGAAGGGAAAAGG + Intronic
929072014 2:38040444-38040466 CTTACATGATGGAAGGGACAAGG - Intronic
929129035 2:38547962-38547984 CTCACATGGCAGAAGGAGCAGGG - Intergenic
929452362 2:42046574-42046596 CTTCCATGTCCAAAGGAACAGGG + Intergenic
929509307 2:42554489-42554511 CTTAGAGGAAAGAAGGAAAAGGG + Intronic
929831125 2:45347351-45347373 CTCACATGGCAGAAGGAGCAAGG + Intergenic
930309162 2:49716047-49716069 CTTTCATGACAGAAGGCAATGGG + Intergenic
931117301 2:59178870-59178892 CTTACATGGCAGAAGGAATGAGG + Intergenic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
932186155 2:69698146-69698168 CTCACATGACTGAAGGAGCAAGG + Intronic
932889322 2:75578514-75578536 CTCACATGACAGAAGGACCAAGG - Intergenic
933086159 2:78057037-78057059 CTTACATGCCAGAAGAAACTGGG - Intergenic
933112671 2:78423675-78423697 CTCACATAGCAGAAGAAACAAGG - Intergenic
933539483 2:83620176-83620198 CAGACATGACAGAAGGCAAAAGG + Intergenic
933638937 2:84739161-84739183 CTTACAAGTCAGAAGAAACTGGG - Intronic
935272578 2:101447952-101447974 CTCACATGGCAGAAGGCAGAAGG + Intronic
935400544 2:102655864-102655886 CTCACATGGCAGAAGGCAGAGGG + Intronic
935708332 2:105875618-105875640 CTCACATGGCAGAAGCAGCAAGG - Intronic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
936262976 2:110978252-110978274 CTCACATGGCAGAAGGCAGAAGG + Intronic
936596900 2:113856778-113856800 CTCACATGGCAGAAGGCAGAAGG - Intergenic
936784792 2:116081603-116081625 ATTCCATGATAGAAGGAACATGG + Intergenic
936881942 2:117263918-117263940 CTTGCAAGACAGAAGGAAGTGGG - Intergenic
937176867 2:119946093-119946115 ATTAAGTGACAGGAGGAACAGGG - Intronic
937666702 2:124496011-124496033 CTTACATGGCAGTAGGATAAGGG - Intronic
938132638 2:128730957-128730979 CTCACATGGCAGAAAGAACGAGG + Intergenic
938175596 2:129124606-129124628 CTTACAAGACAGAAGGGATTGGG - Intergenic
938492290 2:131767891-131767913 CTCACATGACAGAAGGGATGAGG + Intergenic
938495279 2:131794459-131794481 CTCACATGACAGAAGGGATGAGG - Intergenic
938961487 2:136345511-136345533 CTCACATGGCAGAAGGAGCAAGG + Intergenic
938962181 2:136353769-136353791 CTTACATGTCAGAAGAAGGACGG - Intergenic
939372364 2:141317661-141317683 CTTAGATGTCAGACAGAACAGGG + Intronic
939396991 2:141643527-141643549 CCTACATGAAAGAATGAACAAGG - Intronic
939428319 2:142070212-142070234 CTTATAAGAGAGAAGGAAAAGGG + Intronic
939433164 2:142137365-142137387 ATTCCATGGCAGAAGGACCAGGG - Intergenic
939568291 2:143810819-143810841 GTTAAATGAGAGAAGGAACCAGG - Intergenic
940038868 2:149338549-149338571 CTCACATGGCAGAAGAAACAAGG - Intronic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
940325435 2:152420530-152420552 CTTACAAGGCAGAAGTGACAAGG + Intronic
940418435 2:153449792-153449814 CTCACATGACAGAAGGTGGAAGG + Intergenic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
940629371 2:156218288-156218310 CTTACATGGTATAAGGAAAAGGG - Intergenic
941348839 2:164406127-164406149 CTCACATGGCAGAAGGAGCAAGG - Intergenic
941856279 2:170234367-170234389 CTCACATGGCAGAAGGCAGAAGG + Intronic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
943618511 2:190120537-190120559 GTTACATGACAGGAGAAACAAGG + Intronic
944061783 2:195577411-195577433 CATTCATGAAAGAAGGAGCAAGG + Intronic
944156026 2:196608829-196608851 CTTATAAGACAGAAGAAAGAGGG - Intergenic
944263549 2:197699953-197699975 CTTACAAGCCAGAAGGGACTGGG - Intronic
944847668 2:203684891-203684913 TTTACATGATAGAAGGCACCTGG - Intergenic
944977996 2:205079453-205079475 CTTACATGACAGAAGGCAGAAGG + Intronic
945930724 2:215852551-215852573 CTCACATGGCAGAAGGGTCAAGG + Intergenic
946486544 2:220105944-220105966 CTTACAGAACTGAAGGAAGATGG - Intergenic
947052729 2:226064674-226064696 CTTACATGGCAGGAGCAAGACGG - Intergenic
947065914 2:226225426-226225448 CATTCATGACAGAAGGCAAACGG - Intergenic
947069821 2:226276189-226276211 CTCACATGGCAGAAGGAGCACGG + Intergenic
947436432 2:230076766-230076788 CTCACATGATAGAAGGGGCAGGG + Intergenic
1168786043 20:541282-541304 GTTACATGGCAAAAGGAACTTGG - Intronic
1168802224 20:650920-650942 CTTACATGGGAGAAGGGACTTGG + Intronic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1169747137 20:8953912-8953934 CTTGCATGGCAGAAGGGACAAGG + Intronic
1171242133 20:23579911-23579933 CTTACATGCCAGAAGGCACTGGG - Intergenic
1171534057 20:25870610-25870632 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171571231 20:26253484-26253506 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171900715 20:30853767-30853789 CTTACATGGCAGCAGGCAAAAGG + Intergenic
1172886430 20:38234228-38234250 CATACCTGGCAGAAGGAATAGGG - Intronic
1173234174 20:41228572-41228594 CTCACATGGCAGAAGGGACCAGG + Intronic
1173773290 20:45682329-45682351 CTTAGATGACATCAGCAACATGG - Intergenic
1174250358 20:49214887-49214909 AGTCCATAACAGAAGGAACATGG + Intergenic
1174501452 20:50988154-50988176 TTTATATGACAGAAGGAAAGAGG - Intergenic
1176709572 21:10137692-10137714 CTCACATGACAGAAGGGATGAGG + Intergenic
1177080693 21:16635203-16635225 ATCACATGGCAGAAGGAGCAAGG - Intergenic
1177249622 21:18575863-18575885 CTTACAAGCCAGAAGGAATTGGG - Intergenic
1177516216 21:22154554-22154576 CTTACATGTCAGAAGGCAGAAGG + Intergenic
1177755489 21:25342250-25342272 CTTACATGGCAGCAGGCAAAAGG - Intergenic
1177896225 21:26858230-26858252 CTTACATGCTAGAAGGACTAAGG + Intergenic
1178404168 21:32311116-32311138 CTTACATGACACAGGCAAAAGGG + Exonic
1179398440 21:41062125-41062147 CTCACATTCCAGTAGGAACATGG - Intergenic
1180068817 21:45425932-45425954 CCCACATGAAAGAAGCAACAGGG - Intronic
1180113668 21:45681038-45681060 CTTACATGGCGGAAGGCAGAGGG + Intronic
1180204542 21:46250020-46250042 GTTCCAGGACAGAGGGAACATGG + Intronic
1180293671 22:10865005-10865027 CTCACATGACAGAAGGGATGAGG + Intergenic
1180496476 22:15894420-15894442 CTCACATGACAGAAGGGATGAGG + Intergenic
1180567371 22:16684207-16684229 CTTACAAGCCAGAAGGGAGATGG + Intergenic
1180573408 22:16750504-16750526 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1181411992 22:22730619-22730641 CTCACATGACAGAAGGGATGAGG - Intergenic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182483486 22:30625351-30625373 CTCACATGGTGGAAGGAACATGG + Intronic
1182782100 22:32876198-32876220 CTTACATGGCAGAAGGGGCAAGG + Intronic
1182817638 22:33180007-33180029 CTCACATGGCAGAAGGCAGAAGG - Intronic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
949316007 3:2756360-2756382 CTCACATGGCAGAAGGAGCAAGG - Intronic
949480108 3:4485573-4485595 CTTACTTGAAAGAAGAAACAAGG + Intergenic
949802207 3:7916098-7916120 ATTACATGAAAGAGGGAAGAAGG - Intergenic
951061692 3:18215828-18215850 CTCACATGACAGAAAGAGAAAGG - Intronic
951193857 3:19803053-19803075 CTTTCATGCAAGAAGGAAAACGG + Intergenic
951466871 3:23010481-23010503 CCTACATGGCTGAAGGAGCAAGG - Intergenic
951720899 3:25697005-25697027 CTGACATAACAGAAAGACCAAGG - Intergenic
952521907 3:34169379-34169401 CTTACATAACAGAAGGTGGAAGG + Intergenic
952625779 3:35401512-35401534 CTTAAAAGAGAGAAAGAACATGG + Intergenic
952978328 3:38715089-38715111 CTTGCATGAATGAAGGAAGAGGG - Intronic
955505203 3:59625788-59625810 CTTATATGCCAGAAGGGTCAAGG + Intergenic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956122683 3:65981772-65981794 CTTACATGGCAGCAGGCAAAAGG - Intronic
956502058 3:69897369-69897391 CTTGCCAGACAGAAGGAAGAAGG + Intronic
956582137 3:70825959-70825981 CTTGCATGGCAGAAGGGGCAAGG - Intergenic
956774854 3:72556478-72556500 CTCAGATGACAGAAGGAACCAGG + Intergenic
956797843 3:72732315-72732337 CTTGCATGACTGAAGGTCCAGGG - Intergenic
956798327 3:72735809-72735831 CTTGCATGACTGAAGGTCCAGGG + Intergenic
956919187 3:73908267-73908289 CTCACATGGCAGAAGGCAGAAGG - Intergenic
957393403 3:79609027-79609049 CTTACATGGCAGAAGTCAAAAGG - Intronic
957444777 3:80301869-80301891 CTTACATGACAGCAGGCAAAAGG + Intergenic
957736752 3:84213518-84213540 CTTACCAGACAGAAGAAACTGGG + Intergenic
958030724 3:88105966-88105988 ATTACATGGCAGAAGGTAAAAGG - Intronic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
958622660 3:96581684-96581706 ATTTCCTGACAGAAGGAAGAAGG - Intergenic
958891329 3:99786406-99786428 CTTACATGATAAAAGGGGCAAGG - Intronic
959050259 3:101518167-101518189 GTTCTATGACAGCAGGAACAGGG - Intergenic
959540235 3:107528895-107528917 CTTACATTTCATAAAGAACATGG + Intronic
959624895 3:108438646-108438668 CTCACATCACACAAGGAACAAGG - Intronic
959716500 3:109439254-109439276 CATACATGGCAGAAGGGGCAAGG - Intergenic
959752950 3:109859688-109859710 CTTATATGATAAAAGGAGCAAGG - Intergenic
959830977 3:110862157-110862179 CTCACATATCAGAAAGAACAAGG + Intergenic
960241113 3:115343191-115343213 CTCACACGGCAGAAGGAACAAGG - Intergenic
960604519 3:119491082-119491104 CTTTCATGACAGGAGGAGCTAGG + Intronic
960697746 3:120412415-120412437 CTCACATGGCAGAAGGCAGAAGG - Intronic
960769716 3:121180251-121180273 TTTACAAGCCAGAAGGAACTGGG + Intronic
962451985 3:135527469-135527491 CTTACATGGTGGAAGGAGCAAGG - Intergenic
962732890 3:138299567-138299589 GTTTCATGGCATAAGGAACAGGG - Intronic
962991578 3:140582249-140582271 CTTCACTGAAAGAAGGAACAGGG + Intergenic
963713550 3:148776173-148776195 CTTACATGGTAGAAGGCAGAAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964323802 3:155525352-155525374 CTCACGTGACAGAAGGGGCAAGG - Intronic
964738561 3:159942003-159942025 CCAACATGACAGAAAGAAAAAGG + Intergenic
964899269 3:161638094-161638116 CTTAAATGTTAGAAGGAAGATGG + Intergenic
965101814 3:164308728-164308750 CTTACATGGCAGAAGGCAAGAGG + Intergenic
965291165 3:166882871-166882893 CTTACAAGCCAGAAGGAACTGGG + Intergenic
966239731 3:177743121-177743143 CTTACATGGTGGAAGGGACAAGG + Intergenic
966768291 3:183481634-183481656 CTTACTTGACTGAAGGCCCACGG - Intergenic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969216734 4:5729140-5729162 CTTCCTTGCCAGAAGGAAAATGG - Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969692919 4:8715832-8715854 CCTACATTAGAGAAGGAAAATGG + Intergenic
970113562 4:12667775-12667797 CTCACATGGTAGAAGAAACAAGG + Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207533 4:13669837-13669859 CTCATGTGACAGAAGGGACAAGG + Intergenic
970352910 4:15222740-15222762 AATACATGAGAGAAGGAAAATGG + Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
970964562 4:21913397-21913419 CTCACATGGCAGAAGGCAGAAGG - Intronic
971083782 4:23246437-23246459 CTTATAGGACAGAAGGATCCTGG - Intergenic
971243063 4:24906048-24906070 CTTAGATGACTCAAGGAGCAGGG + Intronic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971504047 4:27347419-27347441 CTCATATGGCAGAAGGAGCAAGG + Intergenic
971520286 4:27541345-27541367 CTTACATGATAGAAGCGACTGGG - Intergenic
971520579 4:27545871-27545893 CTCACATGGCAGAAGGCAGAAGG + Intergenic
971996524 4:33972554-33972576 CTCACATGACAGAAGGCAGAAGG - Intergenic
972102385 4:35438004-35438026 CTTGCATGATGGAAGGAACAAGG + Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972226146 4:37015127-37015149 CTCACATGGTGGAAGGAACAAGG - Intergenic
972245053 4:37237455-37237477 CTTACATGGCAGCAGGCAAAAGG + Intergenic
972563473 4:40248963-40248985 ATGACATGACAGAGGGGACAGGG + Intergenic
972961225 4:44454600-44454622 ATTACATGCCAGAAGGCAGAGGG + Intergenic
974342900 4:60637112-60637134 CTTACAAGCCAGAAGAGACAAGG - Intergenic
974519455 4:62963315-62963337 CTTACATGGCAGCAGGAAACAGG - Intergenic
975421862 4:74174101-74174123 CTCACATGGCAGAAGGCACAAGG + Intronic
975623391 4:76316774-76316796 CCTACAAGCCAGAAGGAACTGGG + Intronic
975684946 4:76910456-76910478 TTTACATGATAGAAGGGGCAAGG + Intergenic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
976881307 4:89928837-89928859 CTTACATGGCAAAAGGGACTTGG - Intronic
976983690 4:91265955-91265977 CTTACATGGCAGCAGCAAGAGGG + Intronic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977540068 4:98306364-98306386 CTCACATGACAGAAGGTGGAAGG + Intronic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977748600 4:100581002-100581024 CTCACATGGCAGAAGGAGCAAGG - Intronic
977880498 4:102198949-102198971 CTCACATGGCAGAAGGGATAAGG + Intergenic
977954360 4:103010303-103010325 CTCACATGGCAGAAGGTATAAGG + Intronic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978099138 4:104815269-104815291 CTCACATGACAGAAGGTGGAAGG - Intergenic
978365770 4:107979729-107979751 CTCACGTGATAGAAGGGACAAGG - Intergenic
978421339 4:108536401-108536423 TGTTCATGACAGAAGGAATAAGG - Intergenic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979201650 4:117985981-117986003 CTTACATGAAAAAAGGCACGTGG - Intergenic
979418214 4:120469836-120469858 CTCACATGGCAGAAGGCAGAAGG - Intergenic
979705051 4:123710870-123710892 CTTACAAGACAGAAGGGATTGGG + Intergenic
980013863 4:127625999-127626021 TTTATATTACAGAAAGAACAGGG - Intronic
980196757 4:129599468-129599490 GTCACATGACTGAAGGAGCAAGG + Intergenic
980381083 4:132018573-132018595 CTTGCATCAAAGAAAGAACAAGG + Intergenic
980866579 4:138560524-138560546 CTCACATCTCACAAGGAACATGG + Intergenic
981157141 4:141451807-141451829 CTTACATGGAAGAAGGGGCAGGG + Intergenic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981619217 4:146674723-146674745 CTTATATGAAATAACGAACAAGG + Intergenic
982113458 4:152077090-152077112 CTCACATGGCAGAAGGGACCAGG - Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
982785848 4:159535961-159535983 CCTGCAGGACAGAAGGAATAGGG - Intergenic
982951191 4:161698140-161698162 CTCACATGGCAGAAGGCAGAAGG - Intronic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983563467 4:169125168-169125190 GTTACATCACTGAAGGAGCATGG + Intronic
983842625 4:172476260-172476282 CTAACATGGCAGAAGGAGCAAGG + Intronic
983910554 4:173234198-173234220 CTTACATGATGGATGGAAGAGGG - Intronic
983972741 4:173894487-173894509 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984210958 4:176847511-176847533 TTAACATAACAGAAGGAAAACGG + Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984468888 4:180140071-180140093 TTCACATGATAGAAGGAGCAAGG + Intergenic
984633227 4:182082250-182082272 CTCACATGGCAGAAAGAGCAAGG + Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
984900647 4:184583223-184583245 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984983194 4:185302621-185302643 CTCACATGGCAGAAGGTGCAAGG - Intronic
985254738 4:188058480-188058502 CTCACATGGCAGAAGGCAGAAGG + Intergenic
985325722 4:188767609-188767631 CTTACATGACGAAAGGCAAATGG + Intergenic
986312035 5:6557934-6557956 CCTAGTTGACAGTAGGAACAAGG - Intergenic
986363321 5:7003389-7003411 ATCACAAGACAGAAAGAACATGG + Intergenic
986374667 5:7117819-7117841 CTCAGATAGCAGAAGGAACAAGG - Intergenic
986719044 5:10546994-10547016 CTTCCATAAATGAAGGAACAAGG - Intergenic
986964661 5:13256150-13256172 CTTATATGACAGAAGTCAGAAGG + Intergenic
987507025 5:18785767-18785789 CTTAAATGACATAATGAGCAAGG - Intergenic
987544177 5:19290886-19290908 TTCACATGACAGAAAGGACAAGG + Intergenic
987571062 5:19659709-19659731 CTCACATGGCAGAAGGCAGAAGG - Intronic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
987790538 5:22561347-22561369 CTTACCTGATGGAAGGAAAATGG - Intronic
988321940 5:29709814-29709836 CTCACGTGATGGAAGGAACAAGG + Intergenic
988752056 5:34197892-34197914 CTCACATGGCAGAAGGGTCAAGG + Intergenic
988858139 5:35249065-35249087 CTCACATGGCAGAAGGAGCAAGG + Intergenic
988993953 5:36696634-36696656 ATAAAATGACAGAAGGAAGAAGG - Intergenic
990089396 5:52023145-52023167 CTTACATGTCAGAAAGGATATGG - Intronic
990248159 5:53884311-53884333 TTTACATGAAAGTAGGAAAAGGG + Intronic
990994001 5:61712963-61712985 ACTGCATGACAGAGGGAACATGG - Intronic
991267212 5:64734977-64734999 CTTCCATAACATAAGAAACAAGG - Intronic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
992476278 5:77104502-77104524 CTCACATGGCAGAAGGCAGAAGG - Intergenic
992485924 5:77195200-77195222 CTCACATGGCAGAAGGCAGAAGG + Intergenic
992721371 5:79564607-79564629 CTTACAGGACGGAAGGAAGGGGG - Intergenic
993225723 5:85165779-85165801 CTTACATCAGGGAAGGAAGAAGG - Intergenic
993488423 5:88515470-88515492 CTCACATGGTATAAGGAACAAGG + Intergenic
993527566 5:88985060-88985082 CTTACATGGCAGAAGGCAAGAGG - Intergenic
993752621 5:91689828-91689850 CTTACATGGCAGAAGGTCAAAGG + Intergenic
994131177 5:96229893-96229915 GTTTTATAACAGAAGGAACACGG - Intergenic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
995115589 5:108474540-108474562 CTTACAAGCCAGAAGGCACTGGG + Intergenic
995588456 5:113673623-113673645 CTTACACAACAAAAGGAAGAGGG - Intergenic
995593058 5:113719787-113719809 CTCACATGGCAGAAGGTAAAAGG - Intergenic
995657255 5:114440469-114440491 CTTAAATGTGAGAAGGAATAGGG + Intronic
995796648 5:115948244-115948266 CATACATGACAGCTGGAAAAGGG - Intergenic
996016620 5:118546154-118546176 TTGACAGGACAGAAAGAACACGG + Intergenic
997321131 5:132979634-132979656 CATTCATGACAGAAGGCAAAGGG + Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997672030 5:135683155-135683177 CATACATGACAGAATGAAAATGG + Intergenic
998324076 5:141263301-141263323 CTTATGTGACAGAATGAACAAGG - Intergenic
998933295 5:147205153-147205175 CTTACATGGCGAAAGGAAGAAGG + Intergenic
999499613 5:152133582-152133604 CACACATGACAGAAGGAAAAAGG + Intergenic
1001102735 5:168827635-168827657 CTTACATGGCAAAAGGGACCTGG - Intronic
1002381847 5:178836307-178836329 CTTGCATGGCAGAAGGGGCAAGG + Intergenic
1002400599 5:178989724-178989746 CTAACAGGAAAGAAGGAGCAGGG - Intronic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1002860282 6:1074017-1074039 CTTGAATGACAGAAAGAGCATGG - Intergenic
1003811506 6:9788058-9788080 CATACTAGACAGAAGAAACATGG + Intronic
1003878913 6:10462777-10462799 CTTACATGGCAGAAGAGCCAAGG + Intergenic
1004371763 6:15058943-15058965 CTCAAATGTCAGAAGGAGCAAGG + Intergenic
1004791100 6:19027417-19027439 TTCACATGGCAGAAGGAGCAGGG - Intergenic
1005101254 6:22174367-22174389 CTTACATGGCAGCAGGAGAAAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1007076444 6:39070034-39070056 CTCACATCACAGAAGGCAAAAGG + Intronic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1007790098 6:44303884-44303906 CTTGGATGACAGTAGAAACAAGG + Intronic
1008014243 6:46500604-46500626 GTGTCATGACAAAAGGAACAGGG - Intergenic
1008158507 6:48047728-48047750 CTCACATGATAGAAGGGGCAAGG - Intronic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1008772362 6:54993930-54993952 CTTACAAGCCAGAAGGGACTAGG + Intergenic
1009658788 6:66581994-66582016 CTTGCATGGCAGAAGGCAGAAGG + Intergenic
1009761335 6:68010628-68010650 CTTACAAGAAAGAAGTAAGAAGG + Intergenic
1010070777 6:71742065-71742087 CTTGCATGATAGCTGGAACAAGG + Intergenic
1010628309 6:78166588-78166610 CTCACATGAAAGAAGGGATAAGG + Intergenic
1010673116 6:78710352-78710374 CTCACATGATGGAAAGAACAAGG - Intergenic
1011076747 6:83446572-83446594 CTTACATGCAAGAAGGACTAAGG + Intergenic
1012599618 6:101079063-101079085 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1014303090 6:119707953-119707975 CATAATTGACAGTAGGAACATGG - Intergenic
1014421187 6:121247136-121247158 CTTACAAGCCAGAAGGAACTGGG + Intronic
1014512279 6:122338317-122338339 CTTACATAACATGAGGAACAGGG + Intergenic
1014791588 6:125678586-125678608 CTTACAATAAAGAAGGAAGAAGG - Intergenic
1014918373 6:127182005-127182027 CACTCATGACAGAAGGAAAAGGG + Intronic
1015210112 6:130687249-130687271 CTCACATGGCAGAAGGCACCAGG + Intergenic
1015896647 6:138023949-138023971 CTCACTTGTCAGAATGAACATGG - Intergenic
1015971755 6:138749359-138749381 CTCATATGACAGAAGGAACAAGG - Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016240678 6:141926311-141926333 CTGACATGACAGAGGTAAGAAGG - Intergenic
1016782208 6:147971685-147971707 TTTACATGGCAGAAGGGGCAAGG - Intergenic
1017468406 6:154716489-154716511 CATTCATGGCAGAAGGCACAGGG + Intergenic
1018127018 6:160691637-160691659 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1018149540 6:160925443-160925465 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1019068743 6:169324495-169324517 CTTACATGGTGGAAGGGACAAGG + Intergenic
1019659791 7:2217848-2217870 CTAACCTCACAGAAGGACCACGG + Intronic
1020159577 7:5759169-5759191 CAATCATGACAGAAGGAAAAGGG - Intronic
1020716641 7:11681922-11681944 CTTACAAGCCAGAAGCAACTAGG + Intronic
1021234541 7:18125999-18126021 CCTAGATGAAAGAAGGAAGAAGG - Intronic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021897139 7:25248143-25248165 CTTAAATGTCAGAAGCAAGATGG - Intergenic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1023439323 7:40170060-40170082 CTTGCATGCCAGAAGGACTAAGG - Intronic
1023988875 7:45115990-45116012 CTCACATGGCAGAAGGAGAAAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024683647 7:51720381-51720403 CTTACATGGCAAAAGGAAGAAGG - Intergenic
1024964647 7:55013193-55013215 CTCACATGGCAGAAGGACCAAGG - Intergenic
1025121480 7:56307637-56307659 CTCACATGGCAGAAGGAATGAGG - Intergenic
1026393853 7:69930736-69930758 CTGACAAGACTGAAAGAACAAGG - Intronic
1026507194 7:70994999-70995021 ATCCCATGACAGAAGGAAGAAGG + Intergenic
1026534929 7:71231661-71231683 CTCACATGACAGATAGAGCAAGG + Intronic
1027154864 7:75759708-75759730 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1027336205 7:77153118-77153140 CTTAGATAAAAGAAGGAGCAAGG + Intronic
1027950495 7:84808955-84808977 CTCACATGGCAGAAGGGACCAGG + Intergenic
1028085580 7:86632829-86632851 CATACATGGGAGAATGAACAGGG - Intergenic
1028103858 7:86854407-86854429 CAGACATGAAAGAATGAACATGG + Intronic
1028514648 7:91663693-91663715 CTAACATTACAGAAGGAAATTGG + Intergenic
1028809062 7:95062841-95062863 CTTTCATAATAGAAGAAACATGG - Intronic
1030195735 7:106851769-106851791 CTTACTTGGCAGAAGGCAAAAGG + Intergenic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1030662364 7:112234403-112234425 TTTACATGGCAGAAGGGACAAGG + Intronic
1030874802 7:114800551-114800573 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1030910712 7:115245674-115245696 CACACAAGACAGAAGAAACACGG + Intergenic
1031020240 7:116620120-116620142 CTCACATGATGGAAGGAACAGGG + Intergenic
1031185942 7:118480519-118480541 CTCACATGACAGAAGAAAGAAGG + Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1032932082 7:136684499-136684521 CTTACATGGAAGAAGGGGCAAGG + Intergenic
1032975409 7:137217126-137217148 CTTACATGGCAGAAGGCAAGAGG - Intergenic
1033980217 7:147155214-147155236 CTCACATGGCAGAAGGCTCAAGG - Intronic
1034019719 7:147628295-147628317 CTTACAAGACAGAAAGAATTGGG + Intronic
1034232057 7:149538105-149538127 CTTACATCACAGAAGGCACAAGG - Intergenic
1034278741 7:149837292-149837314 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1034298077 7:149991684-149991706 ATTACGTGTCAGAGGGAACAAGG + Intergenic
1034684986 7:152962574-152962596 CTGACATGGAAGAAGGTACATGG - Intergenic
1034922211 7:155092756-155092778 CTCACATGGCAGAAGGCAAAGGG - Intergenic
1034999910 7:155604282-155604304 CTTACATGGCAGAAGGGACGTGG + Intergenic
1035897735 8:3422904-3422926 CTCACATGGCAGAAGGAAAAGGG + Intronic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1036591233 8:10170360-10170382 CTCACATCACAGAAGGCGCAAGG - Intronic
1036687554 8:10922018-10922040 CTTACATGGCAGAGGGCAGAAGG - Intronic
1037728204 8:21501474-21501496 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1037740645 8:21606335-21606357 CTTACATGGCAGAAGGCAGAAGG - Intergenic
1038298249 8:26316738-26316760 TTGACATGATAGAAGGGACAAGG + Intronic
1039192170 8:34988630-34988652 CTTACATGGTAGAAGAGACAAGG + Intergenic
1040524955 8:48213632-48213654 TTTATATGACAGAAGGCAAAAGG - Intergenic
1040730443 8:50440759-50440781 TTAAGATGACAGAAGGAAGATGG + Intronic
1040781106 8:51110513-51110535 CTTAAATGACAGAGGCAAAAAGG + Intergenic
1041422893 8:57689353-57689375 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1041517276 8:58714346-58714368 TTTACATGGTAGAAGGAGCAAGG - Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1041950726 8:63498145-63498167 CTTACATGGCAGCAGGAAAGAGG + Intergenic
1042389161 8:68213239-68213261 CCAACATGACAGAAGGAAGCTGG + Intronic
1042474687 8:69233818-69233840 CTCACATGACAGAGGGCAGAAGG + Intergenic
1042699450 8:71596077-71596099 CTTAGATGGCAGAAGGCAAAAGG - Intergenic
1043023957 8:75043752-75043774 CTTACAAGTCAGAAGAAACTGGG + Intergenic
1043082637 8:75784973-75784995 CTTCCACGACTGCAGGAACAGGG + Intergenic
1043143631 8:76623162-76623184 TTCACATGACAGAAGGCAAAAGG - Intergenic
1043447700 8:80335264-80335286 CTTTAATGACAGAAGAAAAATGG - Intergenic
1043587069 8:81781793-81781815 CTTACATGCCAAAAGGAACTTGG - Intergenic
1043649031 8:82564114-82564136 CGTACAAGACAGAAAGAGCAAGG + Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1044831391 8:96253402-96253424 CCTACAGGACAGAAGGTAGAAGG - Intronic
1045067444 8:98461809-98461831 CTTACAAGCCAGAAGGGACTGGG - Intronic
1045998776 8:108395218-108395240 CTTACATGGCAGAAGGTGAAGGG + Intronic
1046074182 8:109297530-109297552 CTCACATGACAGAAGGCGGAGGG - Intronic
1046215395 8:111139556-111139578 CTTACACGACAGAAAAAAAATGG - Intergenic
1046359912 8:113137649-113137671 TTCACATGACAGAAGGCAGAAGG + Intronic
1046430260 8:114115002-114115024 CTTACATGACAAAAGGGGCTTGG - Intergenic
1047014641 8:120710653-120710675 CTCACATGGCAGAAGGCAGAAGG - Intronic
1047087691 8:121537149-121537171 TTTGCATGACAAAAGGAACTGGG + Intergenic
1047360857 8:124167846-124167868 CTTGAATGACAGAAGAAACCTGG - Intergenic
1047384022 8:124392852-124392874 CTTACAGGCCAGAAGGGACTGGG - Intergenic
1047441040 8:124879044-124879066 CTTACATGGCGGAAGAAGCAAGG + Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048726475 8:137390973-137390995 CTTACATCTCAGAGGGCACAAGG + Intergenic
1050093659 9:2041430-2041452 CTCACATGGCAGAAGAGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050162958 9:2736897-2736919 CTTACATGACATGTGCAACAGGG - Intronic
1051605692 9:18916047-18916069 CTCACATGACAGAAGGTAGAAGG - Intergenic
1052378733 9:27746138-27746160 CTCACATGGTGGAAGGAACAAGG - Intergenic
1052603429 9:30670090-30670112 CTCACATGACAGAAGAAATAAGG - Intergenic
1055095594 9:72410589-72410611 AATACATGAAAGAATGAACATGG - Intergenic
1055385375 9:75756656-75756678 CTTACAAGACAGAAGCCAGATGG + Intergenic
1055615375 9:78066705-78066727 CTTACATGTTAGAAGGAGCCAGG + Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1056594749 9:87997780-87997802 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1056987127 9:91373664-91373686 CTCACATGATAGAAGGGGCAGGG + Intergenic
1057035108 9:91806324-91806346 CTCACATGGCAGAAGGAGAAAGG + Intronic
1057721130 9:97532759-97532781 CCTACATGAAGGAAGGAAGATGG + Intronic
1058086322 9:100752301-100752323 CTTACATGGCAGCAGGCAAAGGG + Intergenic
1058452087 9:105106526-105106548 CTTACATAACAGAAGGTAGAAGG + Intergenic
1059218874 9:112593173-112593195 TTTACATGACAGAAAGCAAAGGG + Intronic
1059527885 9:115009046-115009068 TTTCCATGATAGAAGGAAAATGG + Intergenic
1059535221 9:115074368-115074390 CTCACAGGACAGAAGGGGCAAGG - Intronic
1060204019 9:121671435-121671457 CTTACATGGCAAAAGGAACTTGG - Intronic
1060607563 9:124930172-124930194 CTTACGTTAGAGAAGGGACAGGG - Intronic
1202794331 9_KI270719v1_random:106659-106681 CTCACATGACAGAAGGGATGAGG + Intergenic
1203369178 Un_KI270442v1:286770-286792 CTTACATGGCAGCAGGCAAAAGG - Intergenic
1185988566 X:4866267-4866289 TTTACAAGAAAGAAGGAAAATGG + Intergenic
1186750448 X:12616258-12616280 TTTACATGGGAGAAGGAGCAAGG - Intronic
1186865515 X:13717226-13717248 CTTACATGACAGCGGGACCTAGG + Intronic
1186880621 X:13862517-13862539 ATTAGATGACAGGAGCAACAAGG + Intronic
1187207416 X:17196500-17196522 CTCACATGATGGAAGGAGCAAGG - Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1188327537 X:28823876-28823898 CTTACATGGCAAAAAGGACATGG - Intronic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1189178467 X:38981215-38981237 CACACATGTCAGAAGGAGCAAGG - Intergenic
1189483083 X:41408072-41408094 CTTACGTGACAAAAGGGACTTGG - Intergenic
1189486517 X:41437038-41437060 CTTGCATGGCAGAAGGCAGAAGG + Intergenic
1189569757 X:42283933-42283955 CTCACATGGCAGAAGGAGCAAGG - Intergenic
1189639161 X:43049362-43049384 CTTACAAGACAGAAGGGATTAGG - Intergenic
1189883226 X:45513204-45513226 GTTACATGCCACAAGCAACAGGG + Intergenic
1189916163 X:45857749-45857771 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1190164025 X:48056706-48056728 CTCACATGGCAGAAGGCAGAAGG - Intronic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1191836821 X:65472139-65472161 CTTACAAGCCAGAAGGAACTGGG - Intronic
1193347909 X:80425564-80425586 CTTAAATGACAAAATGATCAGGG + Intronic
1193698097 X:84734327-84734349 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193903420 X:87212770-87212792 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1194173811 X:90622474-90622496 CTTACATGGTGAAAGGAACAAGG - Intergenic
1194257658 X:91653948-91653970 CAATCATGACAGAAGGCACATGG + Intergenic
1194438917 X:93905284-93905306 CTTACAAGCCAGAAGGAATTAGG - Intergenic
1194463844 X:94207050-94207072 CTAACATGGCAGAAGGCAAAAGG - Intergenic
1194592872 X:95821528-95821550 CTCACATGACAAAAGGAAGAAGG + Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1194957364 X:100196667-100196689 TTTACATGATGGAAGGAATAAGG - Intergenic
1195020936 X:100827725-100827747 CTTTCATGACAGGAGGTCCATGG + Intronic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195454755 X:105055221-105055243 CTCACATGGCAGAAAGAGCAAGG + Intronic
1195805668 X:108762776-108762798 TTTACATGGCAGAAGGCAGAAGG + Intergenic
1195808234 X:108799673-108799695 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1196058221 X:111378932-111378954 CTCACATGGCAGAAGGCAGAAGG - Intronic
1196076738 X:111586073-111586095 CTCACATGGTGGAAGGAACAAGG - Intergenic
1196538182 X:116872470-116872492 CTCACATGACAGAAGGTGGATGG + Intergenic
1197088409 X:122507738-122507760 CTTGCATGACATCAGGAACTAGG - Intergenic
1197556644 X:127963935-127963957 CTTACAAGCCAGAAGGGACTGGG - Intergenic
1197669954 X:129265484-129265506 CATAGATGCCAGAAAGAACAAGG - Intergenic
1198449379 X:136751669-136751691 CTTACATGGTGGAAGGGACAAGG - Intronic
1198622837 X:138533454-138533476 CTTACATGGCTGAAGAAAAAGGG - Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199318892 X:146414939-146414961 CTTACATGCCAAAAGGAACATGG + Intergenic
1199323158 X:146464614-146464636 CTTACAAGCCAGAAGGGACTAGG - Intergenic
1199587019 X:149425230-149425252 CCTACATGCCAGAAGGAATTGGG + Intergenic
1199736062 X:150687759-150687781 CTCACATGGCAGAAGGTAAAAGG - Intergenic
1199884095 X:152001916-152001938 CTTACATGGTAGAAGGGGCAAGG - Intergenic
1200520031 Y:4200164-4200186 CTTACATGGTGAAAGGAACAAGG - Intergenic
1201069101 Y:10128191-10128213 CTTACATGGCAGCAGGCAAAAGG + Intergenic
1201148987 Y:11084767-11084789 CTCACATGACAGAAGGGATGAGG - Intergenic
1201637365 Y:16139084-16139106 CTCACATGATGGAAGGGACAAGG + Intergenic
1201906412 Y:19090256-19090278 CTCACATGGTGGAAGGAACAAGG - Intergenic