ID: 1098081607

View in Genome Browser
Species Human (GRCh38)
Location 12:66791834-66791856
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 866
Summary {0: 4, 1: 15, 2: 51, 3: 169, 4: 627}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098081607_1098081614 28 Left 1098081607 12:66791834-66791856 CCTCCCTGCTTCTGAGTCTCCAG 0: 4
1: 15
2: 51
3: 169
4: 627
Right 1098081614 12:66791885-66791907 GCTTAGCTCCCACTCAAAAATGG 0: 1
1: 0
2: 2
3: 39
4: 228
1098081607_1098081615 29 Left 1098081607 12:66791834-66791856 CCTCCCTGCTTCTGAGTCTCCAG 0: 4
1: 15
2: 51
3: 169
4: 627
Right 1098081615 12:66791886-66791908 CTTAGCTCCCACTCAAAAATGGG 0: 1
1: 0
2: 2
3: 46
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098081607 Original CRISPR CTGGAGACTCAGAAGCAGGG AGG (reversed) Intronic
900550066 1:3250182-3250204 CTGGAGCCTCAGGAGCAATGCGG - Intronic
900885245 1:5410503-5410525 CGAGAGACTCTGAACCAGGGAGG + Intergenic
900903196 1:5531065-5531087 CAGGAGACTTACAATCAGGGAGG - Intergenic
901674072 1:10872766-10872788 ATGGAGGCTCAGAAGCTGAGTGG + Intergenic
901681696 1:10916508-10916530 CTGGTGACAGAGGAGCAGGGTGG - Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902609779 1:17590174-17590196 CTGGAGGCAGAGAAGCACGGTGG - Intronic
902729449 1:18359610-18359632 CTAGAGGCTCAGAACCAGGCAGG - Intronic
902993398 1:20205373-20205395 GTCAAGACTCAGAGGCAGGGTGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904621215 1:31776486-31776508 CTGGGGAGTCAGAGGCAGTGGGG - Intergenic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905348209 1:37326224-37326246 GGGGAGATTCAGAAGCCGGGGGG - Intergenic
905477546 1:38239495-38239517 CTGGAGCCTCAGAACCAAGGTGG - Intergenic
906165251 1:43681281-43681303 AAGGAGACTCAGAAGCAGACAGG - Intronic
906546272 1:46621374-46621396 CTGGCAACTCTGAGGCAGGGAGG - Intergenic
906707346 1:47904328-47904350 CTGGGGGCTGAGAAGCAGGCAGG + Intronic
906849253 1:49230178-49230200 CTGGAGGCACATAAGCAAGGTGG - Intronic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
908703325 1:66924995-66925017 CGGGAGACTCAGAGCCTGGGAGG - Exonic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908932401 1:69332599-69332621 CAGGAAACTCACAATCAGGGCGG + Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
912487300 1:110039343-110039365 CTGCCCACTCAGATGCAGGGAGG + Intronic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912713509 1:111966076-111966098 CTGGGGAGCCAGCAGCAGGGTGG - Intronic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915580823 1:156812266-156812288 CTGGAGACTTACAAGCTGAGGGG - Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
918315513 1:183319484-183319506 CAGGAGAGTCACAAGCAGGCTGG + Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920259383 1:204678631-204678653 CTGGAGAGTCAGAGGCGGCGTGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920713380 1:208316699-208316721 CTGGAGAGTTGGAGGCAGGGAGG + Intergenic
920846335 1:209595912-209595934 CTGCAGACTCTGACGCAGGCTGG + Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923067409 1:230531513-230531535 TTGGAGACTCAAAGGAAGGGTGG + Intergenic
1063142935 10:3271698-3271720 CTGGATGCTCATAAGCAGAGTGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063288539 10:4716137-4716159 TTGGAGACCCAGAAGCGTGGAGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065125501 10:22569713-22569735 CCTGAGAATCAGAAGCAGGGTGG - Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065628433 10:27654059-27654081 CTTGAGAGGCAGAGGCAGGGGGG + Intergenic
1065940505 10:30560104-30560126 ATGCAGAGTCAGAAGCAGCGGGG - Intergenic
1065943093 10:30582699-30582721 TTGGAGACTTAGAGGAAGGGGGG + Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066997486 10:42577550-42577572 CTGGAGAATCAGAAGCCTTGGGG - Intronic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067182079 10:43995867-43995889 CCGGAGACTCACAAGTGGGGAGG + Intergenic
1067312627 10:45128652-45128674 TTGGAGACTCATAAGCAAGGAGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067766979 10:49094196-49094218 CTGGAGCCTCAGAAGCAGTGGGG + Intronic
1067782067 10:49215000-49215022 CTGGAACCCCAGAAGCAAGGGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069034728 10:63634566-63634588 CAGGACACTCGGAAGCAAGGGGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069843683 10:71355922-71355944 CTGAAGCCTCAGAGACAGGGAGG - Intronic
1070407132 10:76107062-76107084 CTGGAATCTAGGAAGCAGGGAGG - Intronic
1070517680 10:77223571-77223593 CAGAAAACTCAGAAGCCGGGAGG + Intronic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071629652 10:87208042-87208064 CTGGAGTCTTAGAAGAAGGGAGG + Intergenic
1071822354 10:89291363-89291385 CTGGAGACTGGGAAATAGGGTGG - Intronic
1071923032 10:90372971-90372993 ATGGAGATTTAAAAGCAGGGAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1074862842 10:117525319-117525341 CTGGGGACAGAGAAGCAAGGAGG - Intergenic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076195143 10:128512441-128512463 CTGTAAACTTGGAAGCAGGGAGG + Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1077435517 11:2536957-2536979 CTCCAGACTCACACGCAGGGAGG - Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1077525205 11:3060105-3060127 TTGGACACTGACAAGCAGGGAGG + Intergenic
1079131301 11:17748432-17748454 CTGGGGACTCCAAAGAAGGGAGG + Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081048702 11:38310546-38310568 CTAGAGCCTCAGAAGGAGCGTGG + Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082834296 11:57640295-57640317 CTGGAGGCTCAGACCCAGGCAGG - Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083710537 11:64545691-64545713 CTGGAGAGGCAGAAGCCTGGGGG - Intergenic
1083859492 11:65412258-65412280 CTGAAGACCCAGACACAGGGAGG - Exonic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1085263571 11:75223350-75223372 CTGACCACTCAGAACCAGGGTGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1087239078 11:95755391-95755413 CTGGAGACCCAAAAGCAGAGTGG + Intergenic
1087292742 11:96338324-96338346 CTGCAGACTCTGCAGCAGCGGGG + Intronic
1087826923 11:102775810-102775832 GTGGATCCTTAGAAGCAGGGTGG - Intronic
1088390204 11:109305645-109305667 CTTCAGACTCAGCAGCAGTGTGG + Intergenic
1088586875 11:111367182-111367204 CAGGAGGCTCAGAGGAAGGGAGG - Intronic
1089139891 11:116276635-116276657 CTGCGGCTTCAGAAGCAGGGCGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089647692 11:119890902-119890924 CAGGAGACCAAGAAGCAGGTGGG + Intergenic
1090037664 11:123262948-123262970 CCAGAGACTCAGAGGCAGGCAGG + Intergenic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090435772 11:126685223-126685245 CTGGGGAGTCAGGGGCAGGGCGG + Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092190055 12:6512639-6512661 CTGGGGAGCCACAAGCAGGGAGG + Intronic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093194342 12:16112306-16112328 CTGGAGCCTGAGAGGCTGGGAGG + Intergenic
1093280193 12:17184810-17184832 CAGGAAACTCACAATCAGGGCGG - Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1095435739 12:42185956-42185978 CTGGGGAGTCCGAAGCAGGTGGG + Intronic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1096121375 12:49091492-49091514 CAGGACACTCAAAAGCTGGGAGG - Intronic
1096466562 12:51849960-51849982 CTGGAGGCTCAACAGCAGGAAGG - Intergenic
1096626098 12:52897103-52897125 CTTGGGACTGAGAAGCTGGGAGG - Intergenic
1096693403 12:53334684-53334706 TCAGAGACCCAGAAGCAGGGAGG + Intronic
1097234069 12:57527995-57528017 CTGGAGACTCTGTAGCAGGCAGG - Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101068663 12:101049929-101049951 CTGGAGAATAAGAATCTGGGTGG - Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101630452 12:106488110-106488132 CTGTGGGCTCAGAAGCAGGCAGG + Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103921052 12:124399354-124399376 CTGGGGGCTCAGCCGCAGGGTGG - Intronic
1104271073 12:127282747-127282769 CTGGAGACACACAGCCAGGGAGG + Intergenic
1104516422 12:129431322-129431344 CTGGAAAATCTGAAGCAGAGAGG - Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104924702 12:132308162-132308184 CTGGAGCCCCAGGAGCTGGGAGG + Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106048639 13:26169205-26169227 CTAGAGTCTGTGAAGCAGGGAGG - Intronic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1107773535 13:43813449-43813471 ATGGAGACTCAGAGGCTGGGTGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1111823054 13:93236388-93236410 CCGGAGACTAAGAAGTAGGGAGG - Intronic
1112239406 13:97666350-97666372 CCTGAGACCCAGAAGCAGTGAGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113091744 13:106624145-106624167 CTGGAGACTGAGGACCAGAGAGG - Intergenic
1113438690 13:110311860-110311882 CTGGAAACTAAGCGGCAGGGTGG - Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115456302 14:33607808-33607830 CAGGAAACTCAGAATCATGGCGG + Intronic
1115618534 14:35119443-35119465 CTCGAGAGGCTGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115814741 14:37151616-37151638 CTGCACACTAAGAGGCAGGGTGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116216842 14:42027479-42027501 CTGGTGAGTCAGAAACAGAGAGG - Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1116950692 14:50875939-50875961 CTGGAGACTAACAGGCAGGGTGG + Intronic
1117074518 14:52088952-52088974 CTAGAGACTCAGAAGACTGGAGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117595144 14:57319735-57319757 CTGGAGGATCTCAAGCAGGGAGG + Intergenic
1118685804 14:68289938-68289960 CTGGAGACTCACAAGCCCAGTGG + Intronic
1119487784 14:75003045-75003067 GTGGAGACCCTGAAGCGGGGTGG + Exonic
1119550997 14:75514132-75514154 CTGGGGACCCAGAAGCTGCGTGG + Intergenic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120346559 14:83298121-83298143 CTGGAGACTTACAATCATGGTGG + Intergenic
1121309434 14:92927433-92927455 CTGGAAACTCAAAACCAGGGTGG - Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121784124 14:96642275-96642297 CTGGAGACTGATAAGTGGGGTGG - Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123045984 14:105515092-105515114 CAGGAGACTTAGAATCATGGCGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127052475 15:55099250-55099272 CGGGAGACTCAGAAACGTGGCGG + Intergenic
1127405609 15:58641916-58641938 CAAGAGGCTCAGAAGCAGGGAGG + Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128345441 15:66850007-66850029 CTGGAGGCTGAGGAGCAGGCTGG - Intergenic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1128700346 15:69799422-69799444 AGGGAGACTCAGAGTCAGGGAGG + Intergenic
1129845909 15:78767640-78767662 CTGCAGGCTCACCAGCAGGGGGG + Intronic
1129999023 15:80031429-80031451 GTGAAGACTCTGAGGCAGGGAGG + Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130813006 15:87402073-87402095 CTGGAGCATCTAAAGCAGGGAGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131035487 15:89219191-89219213 CTGCAGAGTCAGAATCATGGAGG - Intronic
1131182629 15:90250842-90250864 CAGGCGACTTAGAAGCTGGGAGG + Exonic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132587916 16:714373-714395 GTGGAGACACAGGAGCTGGGAGG - Intronic
1132655001 16:1038106-1038128 CTGGAGCCTGTGAACCAGGGTGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133215654 16:4290719-4290741 GTGGACACTGAGAAGCAGAGAGG - Intergenic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134455295 16:14390898-14390920 AGGGACACTGAGAAGCAGGGAGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135059001 16:19255141-19255163 TGGGAGACTCAGGAGCAGGTGGG - Intronic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136451659 16:30357275-30357297 CTGGTGAGACAAAAGCAGGGGGG + Exonic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1137337395 16:47563814-47563836 CTGGAGGCTCAGAAGACTGGAGG - Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137519226 16:49177948-49177970 CTGGAGACTCTGGGGCTGGGGGG + Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139153341 16:64411271-64411293 TTAGAGATTCAGAATCAGGGAGG - Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1139956255 16:70694427-70694449 CTGGAGACAGAAGAGCAGGGGGG - Intronic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140029912 16:71327399-71327421 CTGCAGATTTAGCAGCAGGGAGG - Intergenic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141162856 16:81640609-81640631 CTAGAGTCTCAGAAGCAATGTGG - Intronic
1141352131 16:83307624-83307646 CTCCAGACTCTGAAGCAGTGTGG - Intronic
1141527202 16:84618756-84618778 CTGCAGCCTCAGGGGCAGGGGGG - Intergenic
1142103878 16:88291766-88291788 CAGGACACCCAGACGCAGGGAGG - Intergenic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1143410884 17:6707788-6707810 CTGGAGACTTAGAAGCAGACAGG + Intronic
1143789939 17:9286801-9286823 CCAGAGACTCAGAAAAAGGGTGG + Intronic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1144043224 17:11431231-11431253 CTGGACAGTCAGCAGCAGCGAGG - Intronic
1144750373 17:17644389-17644411 CTGGTCACTCAGAACCAGGCAGG + Intergenic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146187235 17:30731886-30731908 ATGGCGCCTCAGAAGCACGGCGG + Intergenic
1146332277 17:31937247-31937269 ATGGCGCCTCAGAAGCACGGCGG + Exonic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146399945 17:32494394-32494416 CTGCAGGGTCAGCAGCAGGGAGG + Exonic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146790776 17:35749324-35749346 CTGGGGAATGAGAAGCAAGGAGG + Intronic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148582094 17:48751323-48751345 CTGCAGACAGAGAAGCAGAGTGG - Intergenic
1148743134 17:49904006-49904028 CTGGAAACTCAGCTTCAGGGTGG - Intergenic
1148953875 17:51337438-51337460 CAGAAGCCTCAGAATCAGGGAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150572757 17:66402057-66402079 CTGGAGAATGAGAATCGGGGTGG + Intronic
1150976785 17:70096218-70096240 CAGGACACTCACAAGCAGTGAGG - Intronic
1151280337 17:73069224-73069246 CTGGAAACTCAGTGACAGGGAGG - Intronic
1151382250 17:73733991-73734013 CTGGAGCCCCAGGAGCAAGGAGG - Intergenic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152232856 17:79123509-79123531 CCGGAGATTCAGCAGCAGGAGGG - Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152700100 17:81814409-81814431 CAGGAGGCTCAGAGGAAGGGCGG - Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1155087290 18:22470980-22471002 CTGGAGCCCCAGAAGCTGGCTGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1157115981 18:44863247-44863269 CTGGGGACTCTGAAACAGGCAGG - Intronic
1157693160 18:49700174-49700196 ATGGAAACTGAGATGCAGGGAGG - Intergenic
1157814811 18:50722841-50722863 CTGGAGATTGAGAGGCAGGTGGG - Intronic
1157879392 18:51305366-51305388 CTGGAGACTCAGGGGCCAGGGGG + Intergenic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158789966 18:60767216-60767238 CTGGAGATTCAGGGGCAGAGAGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160064060 18:75558546-75558568 CTGGAGCCTCAGTGGTAGGGTGG + Intergenic
1160076791 18:75684989-75685011 TTGGAGGCTCAGGAGCAGTGGGG + Intergenic
1160224278 18:77000000-77000022 ATGTAGACTCAGATGCTGGGGGG + Intronic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160672156 19:370776-370798 CGAGAGTCTCAGATGCAGGGCGG + Intronic
1160845222 19:1163342-1163364 CTGGAGCCCCGGAAGCTGGGAGG + Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1162328458 19:10012230-10012252 CTGGGGAGTCAGAGGCTGGGAGG - Intergenic
1163171247 19:15532746-15532768 TTGGAGTCTCAGAACCAGGCAGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163557481 19:18000991-18001013 CTGTTGAATCAGAAGCAGGCAGG - Intergenic
1164399410 19:27892486-27892508 CTGGACACTGAGGGGCAGGGAGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164446399 19:28321267-28321289 GTGGAGATTCAAAAGCAGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164844739 19:31422338-31422360 CTGGAGAATCCCAAGCAGGTGGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165331854 19:35144621-35144643 CTGCAGAATCCGAAGCAGGGCGG + Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167220482 19:48195646-48195668 TTGGAGAATCAGAAGCCGAGGGG + Exonic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167682429 19:50932245-50932267 CAGGAGGCTGAGGAGCAGGGAGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167929904 19:52855642-52855664 CGGTAGACTCAGAAACAGAGAGG - Intronic
1168427826 19:56253073-56253095 CTGTGGACTTAGAAGCTGGGAGG + Intronic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168527112 19:57098097-57098119 CTGGAGCCGGAGATGCAGGGAGG - Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925157362 2:1658149-1658171 CTGCAGCCTCAGAGGCCGGGCGG - Intronic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926577544 2:14598706-14598728 CTGGAGACTCAGGAGATGGTAGG - Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927012582 2:18920873-18920895 CTGGAGACTCCAAAGATGGGAGG - Intergenic
927284768 2:21345210-21345232 CTGGAGAAAGAGAAGCAGTGTGG - Intergenic
927862891 2:26571126-26571148 CTGGAGACCCAGAGGTAGAGAGG + Intronic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
928738333 2:34319155-34319177 CTGGAGACAGATAAGAAGGGTGG - Intergenic
930156821 2:48114437-48114459 CTGATGACTCAGAATCAGAGAGG + Intergenic
930277120 2:49324708-49324730 CTGGGGACTCCAAAGGAGGGAGG + Intergenic
930379056 2:50604297-50604319 CTGTTGAATCAGAAGCAAGGGGG + Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930554114 2:52873407-52873429 TTGAAGACTCAGAAGAAGAGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931179211 2:59883026-59883048 CTGGTGGCTCAGTAGCAGTGTGG - Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
932486061 2:72085101-72085123 ATGTAGAATGAGAAGCAGGGTGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934579585 2:95427592-95427614 CTGGAGACCCAGCCGCTGGGAGG + Intergenic
934599859 2:95649133-95649155 CTGGAGACCCAGCCGCTGGGAGG - Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935335530 2:102012309-102012331 CTGGAGACTCTGAAGCCAGCTGG - Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
936316058 2:111425163-111425185 CTGGGGACTCAGGAGCAGCCTGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936461324 2:112715545-112715567 CTGGGGGCTCAGAAGAAGGTGGG + Intergenic
936533204 2:113291137-113291159 CTGGAGACCCAGCCGCTGGGAGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936948171 2:117950007-117950029 CTTAAGTCTCAGAGGCAGGGCGG + Intronic
937146116 2:119646370-119646392 CTGGAGACTTACAATCATGGCGG + Intronic
937912362 2:127081789-127081811 CTGGGGTCTCAGCAGCTGGGTGG - Intronic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941887192 2:170540206-170540228 CTGCAGACTCCGAAGTAGGTGGG - Intronic
942261082 2:174164129-174164151 CAGGAGACTTACAAGCATGGTGG - Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947329743 2:229015958-229015980 CTGGAGGCTGAGAAGAATGGTGG + Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
949021866 2:241745312-241745334 GTGGAGACACAGCAGCAGGCAGG - Intronic
1168795695 20:609133-609155 CAGGAGACTGAGAAGAAAGGAGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169927713 20:10800305-10800327 CCTGAGACCCAGAGGCAGGGTGG - Intergenic
1170791214 20:19511054-19511076 CTGCAGGGTCAGCAGCAGGGTGG - Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170813724 20:19695703-19695725 CTGGAGACTGAAAAACAGGAAGG - Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171490550 20:25513816-25513838 CAGGAAACTCAGAATCATGGCGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174857076 20:54056439-54056461 TTGGAGACTCCAAAGAAGGGAGG + Intronic
1175133915 20:56808907-56808929 CTGGAGGCTCAGGAGCAAGCAGG + Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1175949788 20:62577175-62577197 CTATGGACTCAGAAGCACGGAGG - Intergenic
1177213872 21:18104411-18104433 CAGGAAACTCAGAATCATGGCGG - Intronic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181435673 22:22909228-22909250 CAGGAAACGCAGAAGCAGAGAGG - Intergenic
1181536443 22:23548738-23548760 CTGGGGCCTCAGAAGCAGACAGG + Intergenic
1182487731 22:30649378-30649400 ATGGAGACTGAGATTCAGGGAGG + Intronic
1183457451 22:37930419-37930441 CTGGGGTTTCTGAAGCAGGGAGG - Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1184477437 22:44729261-44729283 CGGGAGACTCAGGAACAGTGAGG - Intronic
1184830279 22:46981676-46981698 CAGGAAACTCAGAATCATGGTGG - Intronic
1184919751 22:47597401-47597423 CTGAACACTCAGATACAGGGAGG + Intergenic
1184947706 22:47815875-47815897 CAGGAGACTCAGGGGCAGAGAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185269889 22:49924612-49924634 CGTGAGACACAGAAGCAGTGGGG + Intronic
1185280125 22:49966388-49966410 CTGGAGGCTCCTAGGCAGGGTGG - Intergenic
950157642 3:10735679-10735701 CTGGAGACAGAGACCCAGGGAGG + Intergenic
950157674 3:10735867-10735889 CTGGAGACAGAGACCCAGGGAGG - Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950654580 3:14428676-14428698 CAGGAGACTCAGCAGCCTGGAGG - Intronic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953250239 3:41239222-41239244 CTGGATAGTCAGCACCAGGGTGG - Exonic
953496171 3:43388889-43388911 CTTTAGACTTAGAAGCAGTGAGG - Intronic
953598598 3:44340747-44340769 CTGCAGAATCAGAATCTGGGTGG - Intronic
953786587 3:45915938-45915960 CTGAAGCCTCAAAAGCCGGGCGG - Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956205762 3:66753218-66753240 GTGTGGACTCAGAAGCATGGGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
959916382 3:111821099-111821121 CTGGATACTCAGAATCACTGGGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960558822 3:119059397-119059419 CTGGGGACTCAGGGGAAGGGTGG + Intronic
961821292 3:129577028-129577050 CTGGGACCCCAGAAGCAGGGAGG - Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962174115 3:133134781-133134803 CTACAGACTCAGAAGCGGGGAGG - Intronic
962226945 3:133620928-133620950 CATGAGAGTCAGAAGCAGGCAGG - Intronic
962673227 3:137730580-137730602 ATGGACACTCAGGAGCAAGGTGG + Intergenic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
962930864 3:140034659-140034681 TGGGAGAGTGAGAAGCAGGGAGG + Intronic
962937042 3:140090773-140090795 ATCAAGACTCAGAAGCAGGCTGG + Intronic
963236435 3:142962016-142962038 CTGGAGGCTTTGAAGTAGGGAGG - Exonic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
965491978 3:169348987-169349009 CAGGAGACTGAGAACCAGAGTGG + Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
966486887 3:180481267-180481289 CAGGAGACTTAGAATCATGGTGG + Intergenic
966499305 3:180620921-180620943 CGGAAGACTCAGAAGCATGGTGG - Intronic
967923779 3:194631306-194631328 CTGGAGACACCGAGACAGGGTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969187326 4:5486186-5486208 GTGGAGTCTCAGAGGCAGGCTGG + Intronic
969631591 4:8341844-8341866 CAGGAGACTCAGAGCCAGAGCGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970838382 4:20438135-20438157 TTGGAGAATCATAAGAAGGGAGG - Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975361166 4:73474103-73474125 CTGGAAACTCACAATCATGGTGG + Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976595561 4:86892190-86892212 CTGGCGAGTCGGAGGCAGGGTGG - Intronic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977090697 4:92671709-92671731 CTGGATAGTGAGAAGCAAGGAGG + Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980627378 4:135391023-135391045 CAGGAAACTCAGAATCATGGTGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981389345 4:144170436-144170458 CTGGAGGCTGTGCAGCAGGGTGG + Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983555993 4:169059685-169059707 CTTGACAGTCAGAAGCAGGCAGG - Intergenic
983850538 4:172575074-172575096 ATGCAGACTCAAATGCAGGGAGG + Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985686869 5:1286177-1286199 GTGGAGACTCACGAGGAGGGCGG - Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986326432 5:6678641-6678663 CCAAAGACTCAGAACCAGGGAGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987580301 5:19782185-19782207 CAGGAGACTCACAATCATGGTGG + Intronic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989464485 5:41739168-41739190 CTTAGGACTCAGAAGCAGGAAGG - Intronic
990978288 5:61578313-61578335 ATGGAGACTCTGAGGCGGGGAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993082019 5:83313186-83313208 CAGAAGATTCAGAGGCAGGGTGG - Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993277280 5:85876872-85876894 CTGGAGAATCTGAACCTGGGAGG - Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997354218 5:133252036-133252058 CTGGACACTCAGAAGCCAGCCGG + Intronic
997636730 5:135414476-135414498 TCGAAGACTCAGAAGCAGGGAGG + Intergenic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998533653 5:142908872-142908894 GAGGAGACTCACAAGCAGGCAGG - Intronic
999172305 5:149605969-149605991 CTGGAGAAGGACAAGCAGGGAGG + Intronic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001466395 5:171970370-171970392 CAGGAAACTTAGAAGCATGGTGG - Intronic
1001746506 5:174096640-174096662 CTGGAGGCCCAGGAGCAGTGAGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1002770935 6:290673-290695 CAGGTGACTGAGAAGCAGGCGGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005088321 6:22029839-22029861 ATGGAGACTGAGAAGGAGAGAGG + Intergenic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1006083404 6:31580385-31580407 CTGGCCATTCAGAGGCAGGGAGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006525482 6:34601105-34601127 CTGGAGGCTGGGAAGCAGGGAGG + Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009315808 6:62218990-62219012 CTAGAGATTCAGAAGCACAGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1009925931 6:70120712-70120734 ATGGATACTTAGAAGCAGGCTGG - Intronic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011402787 6:86982040-86982062 CTGGAGAATAAGAACCAGGTGGG + Intronic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1011738828 6:90339021-90339043 CTGTTGACTCAGAGGCATGGAGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012137769 6:95579698-95579720 CAAGAGATTCAGAAGCAGGGTGG - Intronic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1015928682 6:138335028-138335050 CTGGGGACGCTGAAGCAGCGGGG - Exonic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016529640 6:145043362-145043384 CGTGAAACTGAGAAGCAGGGAGG - Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017916569 6:158836151-158836173 TGGGAGGCTCAGCAGCAGGGGGG + Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019429494 7:992189-992211 CTGGAGACCTAGAGGCGGGGGGG - Intergenic
1019513370 7:1429365-1429387 CTGGAGCCCAAGACGCAGGGGGG - Intronic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021827869 7:24573119-24573141 CTGGGCGCTCAGAAGCTGGGAGG + Intergenic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1022190854 7:28015889-28015911 CTGGAGCCTGGGGAGCAGGGGGG - Intronic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1022459272 7:30588780-30588802 TGGGAGGCTGAGAAGCAGGGCGG + Intergenic
1022724027 7:32964831-32964853 CTGCAGACTTGAAAGCAGGGAGG - Intronic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1022947086 7:35297265-35297287 CTGGGGACTAAGGAGCAGAGAGG - Intergenic
1024156295 7:46629177-46629199 CTGGAGACCCAGACCCAAGGAGG + Intergenic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024584747 7:50832394-50832416 CTGGAAATTCAGAAATAGGGTGG + Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024960567 7:54970636-54970658 CTGGAGACTCCTCAGCAGGAGGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025049585 7:55723084-55723106 CTGCAGACTTGAAAGCAGGGAGG + Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028404780 7:90463605-90463627 TTGGAGGCTCAGAAGAAGAGAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030997931 7:116381016-116381038 CAGGAAACTCAGAATCACGGTGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031521949 7:122777755-122777777 CAGGAAACTTACAAGCAGGGCGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031974204 7:128083776-128083798 CTTGCGTCTCAGAAGCAAGGAGG - Intronic
1033647037 7:143313091-143313113 GTAGAGGCTCAGAAGGAGGGAGG + Intergenic
1033892133 7:146026473-146026495 TTAGAGACTCAGAAGACGGGAGG - Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034291381 7:149934773-149934795 CTCGAAACTCAGAGGCAGCGTGG - Intergenic
1034814717 7:154162121-154162143 CTCGAAACTCAGAGGCAGCGTGG + Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035582708 8:749919-749941 GTGGAGACAGAGAAGCAGGCTGG - Intergenic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037407042 8:18554076-18554098 CTGTCGACTCAAAAGTAGGGAGG + Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039241746 8:35564751-35564773 CTGGATTCTCAGAAGTGGGGAGG - Intronic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1039836131 8:41257714-41257736 CTGGAGACTCAGAAGATCAGAGG - Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040384499 8:46905101-46905123 CTGGAGACAGAGAACCAGCGAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041197595 8:55416623-55416645 CTGGAGGATCACAAGCAGGGGGG + Intronic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041797751 8:61763486-61763508 CTTGAGCCTCAGCAGCAAGGGGG - Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043191517 8:77228356-77228378 TTGGAGACTCTGCAGCAGTGAGG + Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044817856 8:96131324-96131346 TTGGAGACAGAGATGCAGGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1044927470 8:97221846-97221868 CTAGAGTCTCAGAGGCAGTGTGG + Intergenic
1045037137 8:98184572-98184594 TTAGCGACTGAGAAGCAGGGTGG + Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045552208 8:103182830-103182852 CAAGAAACTCAGAGGCAGGGAGG + Intronic
1045891082 8:107158421-107158443 CTGGAAGCTCAAAAGCAAGGGGG - Intergenic
1046198968 8:110897102-110897124 ATAGAGACTCAGTAGCAGGCAGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046367048 8:113248037-113248059 CTTGAGAGTCAGATGCAGTGTGG - Intronic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047670537 8:127141639-127141661 CTGGGGACTCAGATACAGAGAGG - Intergenic
1047814464 8:128447758-128447780 CTGGAGAGTAAGAAGGAGAGGGG + Intergenic
1048312081 8:133331654-133331676 CTCCAGACTCAGGAGGAGGGTGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048739879 8:137544210-137544232 CTGGAAACCAAAAAGCAGGGAGG - Intergenic
1049230889 8:141480573-141480595 CTGGGGACTCAAAAGAAGGGAGG - Intergenic
1049691780 8:143964537-143964559 CTGGAGCCTCCGAAGGAGCGTGG + Intronic
1049747665 8:144269851-144269873 CTGGTGAGTGAGGAGCAGGGTGG + Intronic
1050027255 9:1348654-1348676 TTGGAGACACAGAAGCTGAGAGG + Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1051183755 9:14438106-14438128 GGGGGGACTGAGAAGCAGGGAGG + Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053062624 9:35043895-35043917 CTGGAGACTCAAAAGCCCAGAGG - Exonic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053097465 9:35341021-35341043 CTGGAGACTCACTAGCCAGGTGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1055252448 9:74324121-74324143 CAGGAGTTTCAAAAGCAGGGAGG + Intergenic
1055693788 9:78861125-78861147 CTGGAGCCTGAGTAGCAGGATGG - Intergenic
1056753267 9:89366907-89366929 CTTGAGACTAAGAATCTGGGTGG + Intronic
1057132096 9:92661383-92661405 CTGGTGACTCAGTAGCAGCGAGG - Intronic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058261190 9:102834657-102834679 CTTGAGAGTCAGAAACAGGAGGG - Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1059051174 9:110927025-110927047 CAGGTGACTCAGATGCAAGGTGG + Intronic
1059377732 9:113898983-113899005 CTGGAGACTCTGAGGCAGGCTGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059973528 9:119692108-119692130 CTGGGGACTCAGAAGAGGAGAGG - Intergenic
1060338276 9:122748690-122748712 ATAGAGACTCAGAAGAAGTGGGG - Intergenic
1061057497 9:128232309-128232331 CTTGAGCCTCAGGAGCAGTGGGG + Intronic
1061779910 9:132989335-132989357 TTGGAGACCCAGACCCAGGGAGG - Intronic
1062250908 9:135592978-135593000 CTGGGGTCTCAGAGGCTGGGGGG + Intergenic
1062604110 9:137336124-137336146 CTGGAGGCTCAGAGGTGGGGAGG + Intronic
1185822912 X:3221846-3221868 CAGGACACTCTGAGGCAGGGGGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188158113 X:26767124-26767146 TTGGAGATGCAGAAGCATGGGGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188208509 X:27389947-27389969 GTGGAGACTCAAAGGCAGGCAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189343711 X:40224168-40224190 CAGGAGGCTGAGAGGCAGGGGGG + Intergenic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189522705 X:41786475-41786497 TTTGAGAGTCTGAAGCAGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1189929092 X:45988991-45989013 CTGGGCACTCAGTAGCAGAGTGG - Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191178398 X:57531987-57532009 TTGGAGACTCAAAAGAAAGGAGG + Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192215943 X:69158235-69158257 CTGGAGAATCAGAAACTGGCAGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193934762 X:87603889-87603911 CTAGAGACTGGGAAGCAGTGGGG - Intronic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194280732 X:91950306-91950328 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195227654 X:102814731-102814753 CTGCAGAATCAAAACCAGGGAGG + Intergenic
1196486001 X:116207832-116207854 CTGGATAATCAGAAGTTGGGAGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196838395 X:119834926-119834948 CTGGAGATTCAGCAGCAGAAAGG - Exonic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197708496 X:129650404-129650426 CTGCAGGCTCAGAAGCCTGGGGG - Intronic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200477635 Y:3659800-3659822 CTGGAGACTACAAAGTAGGGAGG - Intergenic
1200598216 Y:5173862-5173884 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic