ID: 1098088145

View in Genome Browser
Species Human (GRCh38)
Location 12:66870597-66870619
Sequence ATAATTTCTGTATTTAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098088145_1098088149 30 Left 1098088145 12:66870597-66870619 CCTAATCTAAATACAGAAATTAT No data
Right 1098088149 12:66870650-66870672 CGGACATGAAGATGAAAAGGAGG No data
1098088145_1098088146 10 Left 1098088145 12:66870597-66870619 CCTAATCTAAATACAGAAATTAT No data
Right 1098088146 12:66870630-66870652 AACTTCGCCAAATTTGAGCACGG No data
1098088145_1098088148 27 Left 1098088145 12:66870597-66870619 CCTAATCTAAATACAGAAATTAT No data
Right 1098088148 12:66870647-66870669 GCACGGACATGAAGATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098088145 Original CRISPR ATAATTTCTGTATTTAGATT AGG (reversed) Intergenic
No off target data available for this crispr