ID: 1098088147

View in Genome Browser
Species Human (GRCh38)
Location 12:66870637-66870659
Sequence TTCATGTCCGTGCTCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098088147_1098088150 0 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088150 12:66870660-66870682 GATGAAAAGGAGGTAGAGACTGG No data
1098088147_1098088151 1 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088151 12:66870661-66870683 ATGAAAAGGAGGTAGAGACTGGG No data
1098088147_1098088152 18 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088152 12:66870678-66870700 ACTGGGTTCATGCTTCTGACAGG No data
1098088147_1098088153 26 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088153 12:66870686-66870708 CATGCTTCTGACAGGATTATTGG No data
1098088147_1098088149 -10 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088149 12:66870650-66870672 CGGACATGAAGATGAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098088147 Original CRISPR TTCATGTCCGTGCTCAAATT TGG (reversed) Intergenic
No off target data available for this crispr