ID: 1098088152

View in Genome Browser
Species Human (GRCh38)
Location 12:66870678-66870700
Sequence ACTGGGTTCATGCTTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098088147_1098088152 18 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088152 12:66870678-66870700 ACTGGGTTCATGCTTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098088152 Original CRISPR ACTGGGTTCATGCTTCTGAC AGG Intergenic
No off target data available for this crispr