ID: 1098088153

View in Genome Browser
Species Human (GRCh38)
Location 12:66870686-66870708
Sequence CATGCTTCTGACAGGATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098088147_1098088153 26 Left 1098088147 12:66870637-66870659 CCAAATTTGAGCACGGACATGAA No data
Right 1098088153 12:66870686-66870708 CATGCTTCTGACAGGATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098088153 Original CRISPR CATGCTTCTGACAGGATTAT TGG Intergenic
No off target data available for this crispr