ID: 1098088197

View in Genome Browser
Species Human (GRCh38)
Location 12:66871183-66871205
Sequence TCTGGAATGCAGACTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098088195_1098088197 -2 Left 1098088195 12:66871162-66871184 CCTTTTGCTTAGGAATTAGGGTC No data
Right 1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098088197 Original CRISPR TCTGGAATGCAGACTGTTGA AGG Intergenic
No off target data available for this crispr