ID: 1098095245

View in Genome Browser
Species Human (GRCh38)
Location 12:66947434-66947456
Sequence CAGTGATTAAGGAGAAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098095245_1098095249 11 Left 1098095245 12:66947434-66947456 CCTTGGTTTCTCCTTAATCACTG No data
Right 1098095249 12:66947468-66947490 GATTAATCCCAAATGCTGGTGGG No data
1098095245_1098095247 7 Left 1098095245 12:66947434-66947456 CCTTGGTTTCTCCTTAATCACTG No data
Right 1098095247 12:66947464-66947486 TGCTGATTAATCCCAAATGCTGG No data
1098095245_1098095248 10 Left 1098095245 12:66947434-66947456 CCTTGGTTTCTCCTTAATCACTG No data
Right 1098095248 12:66947467-66947489 TGATTAATCCCAAATGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098095245 Original CRISPR CAGTGATTAAGGAGAAACCA AGG (reversed) Intergenic
No off target data available for this crispr