ID: 1098099493

View in Genome Browser
Species Human (GRCh38)
Location 12:66999067-66999089
Sequence ATGAAGAAAATGTCTGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098099493_1098099494 -5 Left 1098099493 12:66999067-66999089 CCACATTCAGACATTTTCTTCAT No data
Right 1098099494 12:66999085-66999107 TTCATAACAATGATAACATCAGG No data
1098099493_1098099495 18 Left 1098099493 12:66999067-66999089 CCACATTCAGACATTTTCTTCAT No data
Right 1098099495 12:66999108-66999130 AAAAAACAGTTCCAAGACTGAGG No data
1098099493_1098099496 26 Left 1098099493 12:66999067-66999089 CCACATTCAGACATTTTCTTCAT No data
Right 1098099496 12:66999116-66999138 GTTCCAAGACTGAGGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098099493 Original CRISPR ATGAAGAAAATGTCTGAATG TGG (reversed) Intergenic
No off target data available for this crispr