ID: 1098100205

View in Genome Browser
Species Human (GRCh38)
Location 12:67007141-67007163
Sequence GGTGATGGGCAGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098100197_1098100205 21 Left 1098100197 12:67007097-67007119 CCAGTCTAAATGCTAACAACTTT No data
Right 1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098100205 Original CRISPR GGTGATGGGCAGAGGGTAGA GGG Intergenic
No off target data available for this crispr