ID: 1098102566

View in Genome Browser
Species Human (GRCh38)
Location 12:67033959-67033981
Sequence GATTAGGCTTAGAACTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098102566_1098102569 16 Left 1098102566 12:67033959-67033981 CCTCAGGAGTTCTAAGCCTAATC No data
Right 1098102569 12:67033998-67034020 AAACTTAAATTGTTATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098102566 Original CRISPR GATTAGGCTTAGAACTCCTG AGG (reversed) Intergenic
No off target data available for this crispr