ID: 1098106072

View in Genome Browser
Species Human (GRCh38)
Location 12:67069653-67069675
Sequence TCAGCCTCGCGCGCGTCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098106072_1098106079 -9 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106079 12:67069667-67069689 CGAGGCTGAGCGGGCACGGAGGG No data
1098106072_1098106083 23 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106083 12:67069699-67069721 GCTCACACCCTCCGCGCCCCGGG No data
1098106072_1098106082 22 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106082 12:67069698-67069720 CGCTCACACCCTCCGCGCCCCGG No data
1098106072_1098106084 26 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106084 12:67069702-67069724 CACACCCTCCGCGCCCCGGGCGG No data
1098106072_1098106080 -8 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106080 12:67069668-67069690 GAGGCTGAGCGGGCACGGAGGGG No data
1098106072_1098106078 -10 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106078 12:67069666-67069688 GCGAGGCTGAGCGGGCACGGAGG No data
1098106072_1098106081 -7 Left 1098106072 12:67069653-67069675 CCCCGAGACGCGCGCGAGGCTGA No data
Right 1098106081 12:67069669-67069691 AGGCTGAGCGGGCACGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098106072 Original CRISPR TCAGCCTCGCGCGCGTCTCG GGG (reversed) Intergenic