ID: 1098113591

View in Genome Browser
Species Human (GRCh38)
Location 12:67150692-67150714
Sequence GTATCCACTAAATTTAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098113591_1098113595 17 Left 1098113591 12:67150692-67150714 CCCTATTTAAATTTAGTGGATAC No data
Right 1098113595 12:67150732-67150754 CTGAGAGCAATGCCAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098113591 Original CRISPR GTATCCACTAAATTTAAATA GGG (reversed) Intergenic
No off target data available for this crispr