ID: 1098119071

View in Genome Browser
Species Human (GRCh38)
Location 12:67216283-67216305
Sequence TAGGCTACTTTAGATTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098119062_1098119071 23 Left 1098119062 12:67216237-67216259 CCTATAACGGAAATAAAACAGAC No data
Right 1098119071 12:67216283-67216305 TAGGCTACTTTAGATTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098119071 Original CRISPR TAGGCTACTTTAGATTGGAT GGG Intergenic
No off target data available for this crispr