ID: 1098123463

View in Genome Browser
Species Human (GRCh38)
Location 12:67266788-67266810
Sequence TGAAGCAGCTTGGAAACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098123459_1098123463 7 Left 1098123459 12:67266758-67266780 CCTCTGCTTGAGGATTGTGGGTC 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1098123463 12:67266788-67266810 TGAAGCAGCTTGGAAACCACCGG 0: 1
1: 0
2: 3
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098123463 Original CRISPR TGAAGCAGCTTGGAAACCAC CGG Intergenic
900852270 1:5153495-5153517 TGAAGCAGCTGAGGCACCACAGG - Intergenic
901661346 1:10799753-10799775 TGAAGGACCTTGGTGACCACGGG - Intergenic
902720132 1:18298500-18298522 TGAAGCATCCTGAAAGCCACAGG + Intronic
905024051 1:34837737-34837759 TGCAGCTGCTGGGAAACCAGGGG - Intronic
906087691 1:43149874-43149896 ACAAGCAGCTTGGAGACCACTGG + Intronic
909200307 1:72683698-72683720 TGAGACAGCTGGGAAACCAATGG + Intergenic
910720082 1:90276082-90276104 TGAAGCAGTTTGCAAACCTAAGG + Intergenic
912122231 1:106485757-106485779 TCAGGCAGCTTGGAAACCTTGGG + Intergenic
917320350 1:173774647-173774669 TCCAGCAGCTTGGAAAGCAGGGG - Intronic
917486665 1:175461141-175461163 TGAAACAACCTGGAAACCCCAGG + Intronic
922327455 1:224541990-224542012 TGAAGAAAATTGGAAGCCACTGG - Intronic
923064611 1:230506634-230506656 TGAAACAGCTGGAAAACAACTGG - Intergenic
923784887 1:237057074-237057096 TGAGGCAGATTGGAGGCCACTGG + Intronic
1064328956 10:14376129-14376151 TGAACCAGCTCTGAACCCACTGG + Intronic
1064346579 10:14537974-14537996 TTAAGCAGCTTGGTAACCTTGGG - Intronic
1064373642 10:14776229-14776251 AGAAACAGCTTGGATAGCACGGG - Intergenic
1065740448 10:28792314-28792336 TCAGGCAGATCGGAAACCACTGG - Intergenic
1066273413 10:33845307-33845329 GGAAGCAACTTTGAAACTACTGG - Intergenic
1068755579 10:60648843-60648865 AGAAGCAGCTTGGAAATAGCTGG - Intronic
1069926482 10:71854237-71854259 TGAAGCAGCTTTGAAACAGGAGG + Intergenic
1074134548 10:110615354-110615376 AGAAGCACCCTAGAAACCACTGG - Intergenic
1075774860 10:124976282-124976304 GGAAGCTGCTTGGTGACCACAGG - Intronic
1080086026 11:28283334-28283356 TCAAGCACCTTAGAAACCATGGG + Intronic
1080184039 11:29457860-29457882 TGAAGCATCTTAGAGACCAGGGG - Intergenic
1081765901 11:45610017-45610039 AGAAGCAGCATGGACACCAGGGG + Intergenic
1082122740 11:48397001-48397023 CCCAGCAGCTTGGCAACCACTGG + Intergenic
1082251889 11:49991673-49991695 CCCAGCAGCTTGGCAACCACTGG - Intergenic
1082556443 11:54568282-54568304 CCCAGCAGCTTGGCAACCACTGG + Intergenic
1084370297 11:68737518-68737540 TGCAGGAGCCTGGAAAGCACTGG + Intronic
1085138929 11:74121950-74121972 AGAAGCAGATAGGAAGCCACTGG - Intronic
1085557835 11:77441405-77441427 CAAAAAAGCTTGGAAACCACTGG - Intronic
1086281318 11:85192861-85192883 TGTGGCAGCATGGAAAGCACAGG + Intronic
1087914640 11:103795871-103795893 TTAAACAGCATGGAAACCAGAGG - Intergenic
1088069670 11:105766721-105766743 TGAATGAGCTAGGAAGCCACTGG - Intronic
1088184110 11:107144281-107144303 TGAAGCTACCTGGAAACCACAGG + Intergenic
1088373489 11:109116462-109116484 AGAGGCAGCTAGGAAAACACAGG - Intergenic
1089395812 11:118135911-118135933 GGAAGCAGCTGGGAAACCCAAGG + Exonic
1089437177 11:118479376-118479398 TTAAGCATCTTGTAAACTACTGG + Intronic
1089600801 11:119613566-119613588 TGGAACACCTTGGACACCACGGG + Intergenic
1091758021 12:3068080-3068102 TGAAGGAGATTGGAAATCAAGGG - Intergenic
1093488179 12:19675500-19675522 TGAATCAGTTGGGTAACCACAGG - Intronic
1095942385 12:47735575-47735597 TGGGGCAGCTGGGAGACCACCGG + Intronic
1096524772 12:52203903-52203925 TGGAGCAGCCAGGGAACCACAGG + Intergenic
1098123463 12:67266788-67266810 TGAAGCAGCTTGGAAACCACCGG + Intergenic
1098970912 12:76856073-76856095 TCAAACTGTTTGGAAACCACAGG + Intergenic
1099078126 12:78137932-78137954 TAAATCAGCTTGAAAACCTCAGG + Intronic
1099574349 12:84361968-84361990 GGAAGCAGATTGCAAACCGCTGG - Intergenic
1100104068 12:91147077-91147099 TGCATGAGATTGGAAACCACTGG - Intronic
1101999534 12:109548310-109548332 TCAAGCAGCCTGGAGACCATAGG + Intergenic
1104307546 12:127623152-127623174 AGAAACAGCTTGGGAAACACTGG - Intergenic
1104598645 12:130137638-130137660 TGAAGCTGCTTGGAGGCCAGGGG + Intergenic
1105576604 13:21658919-21658941 GGAAGCAGCTGGGTAAACACTGG + Intergenic
1105942836 13:25165444-25165466 TGAAGCAGTTTGGAACCAAAGGG - Intronic
1109475427 13:62875037-62875059 TGAAGATGCTGGGAAACCTCTGG - Intergenic
1110307672 13:74008856-74008878 TGAAGCAGGTTGGGAGCTACTGG - Intronic
1110985540 13:81962900-81962922 TGAAGCAGCATGGATGCAACTGG + Intergenic
1111132577 13:83996449-83996471 TGAAGAAGCTCAGAAACCAGAGG - Intergenic
1112184719 13:97116501-97116523 AAAAACAGATTGGAAACCACTGG - Intergenic
1113776094 13:112945935-112945957 TGAAGCCACATGGAAGCCACAGG - Intronic
1114244209 14:20897585-20897607 TGGTGCACCTTGGAAACCATAGG - Intergenic
1114517725 14:23310711-23310733 CCAAGCAGTTTGAAAACCACTGG - Exonic
1116118529 14:40691395-40691417 AGAAGAAGCTTGGAAAACATAGG + Intergenic
1116376170 14:44204088-44204110 CGAAGCAGTTTGATAACCACTGG - Intergenic
1117107998 14:52418473-52418495 TGAACCTGCTTGGGAACCCCTGG - Intergenic
1122954486 14:105064145-105064167 TGAAACAGCTTAGAAATTACAGG - Intronic
1124097895 15:26666505-26666527 TGAAGCAGTTCAGAAACTACAGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127788798 15:62380072-62380094 GGAAGCAGTTTGAAAACCAGGGG + Intergenic
1129513805 15:76144288-76144310 TGGGGCATCTTGGAACCCACTGG - Intronic
1133334082 16:4995399-4995421 TTTAGCAGCCTGGGAACCACAGG - Intronic
1135915530 16:26602330-26602352 TGAAGGAGCCTGGAAATCACTGG + Intergenic
1136040883 16:27577926-27577948 TGTAGCAGTTTGAGAACCACTGG + Intronic
1138710557 16:58965924-58965946 GGAAGCAGCTTGATAACCCCAGG + Intergenic
1141255908 16:82402108-82402130 TGAGGGAGATGGGAAACCACTGG + Intergenic
1143161272 17:4873019-4873041 TTCAGCAGCTCGGAAACCACTGG - Intronic
1144878501 17:18417245-18417267 TGATGCTGCTTGGTAAACACTGG - Intergenic
1144885250 17:18453994-18454016 TGATGCTGCTTGGTAAACACTGG + Intergenic
1145146967 17:20490382-20490404 TGATGCTGCTTGGTAAACACTGG - Intergenic
1145153733 17:20527142-20527164 TGATGCTGCTTGGTAAACACTGG + Intergenic
1145825214 17:27871826-27871848 TGAAACAGGTTGGGAAGCACAGG - Intronic
1146761103 17:35479809-35479831 TCATGGAGCTTGGAAACCTCTGG - Exonic
1147229932 17:39010141-39010163 TGAAGCAGTGTGGAACCCACTGG + Intergenic
1149067455 17:52497184-52497206 TGAAGCATCATGGAAATCAAAGG - Intergenic
1149450461 17:56746106-56746128 TCAAGCAGCTGGGATCCCACTGG - Intergenic
1150413177 17:64964111-64964133 TGAAACAGCTGGATAACCACAGG + Intergenic
1150839403 17:68594040-68594062 TCAGGCAGCTAGAAAACCACAGG - Intronic
1151188323 17:72379807-72379829 AGAACCTGTTTGGAAACCACTGG + Intergenic
1152816218 17:82409619-82409641 TGACTCAGCTTAGAAACGACTGG + Intronic
1153351520 18:4085639-4085661 TGATGCAGCTTCCAAATCACAGG + Intronic
1155838474 18:30616940-30616962 TCAAGCAAATTGGAAAGCACAGG - Intergenic
1157030772 18:43905082-43905104 TCAAGCAGCTTGTAAAATACAGG - Intergenic
1157802160 18:50629676-50629698 TGGACCATGTTGGAAACCACTGG + Intronic
1158213612 18:55076843-55076865 GGAAGCCTCCTGGAAACCACAGG - Intergenic
1160216477 18:76937029-76937051 TGGTGCAGCTTGGAGACCTCGGG + Intronic
1163026706 19:14517116-14517138 GGAAACAGCTTGGAAGCCATGGG + Intronic
1163290525 19:16376632-16376654 TGAAGCAGCTGGGAAGGGACTGG + Intronic
1163423620 19:17228740-17228762 TTAAGCAGCTTGAAGGCCACAGG + Intronic
1165103277 19:33452867-33452889 TGAAACAACTTGGAAAGCATAGG - Intronic
1165448207 19:35868423-35868445 TGGAGCAGCTCGGGAACCCCGGG - Exonic
1165870530 19:38969564-38969586 GGAATCACTTTGGAAACCACTGG + Intronic
1166073438 19:40399625-40399647 TGTAGCACCTTGGAAGCCAAGGG - Intronic
1168534186 19:57155236-57155258 TGAACCACATTGGAAACAACAGG + Intronic
925910004 2:8567619-8567641 GGAGGCAGCCTGGAAGCCACTGG - Intergenic
926648446 2:15315609-15315631 TGAAGCAGCTGGGAGGCCATGGG - Intronic
927310987 2:21630922-21630944 GGAAGCACTTTGGAAACCAATGG - Intergenic
931173188 2:59826678-59826700 AAAAGCAGCTTGAAAACCATGGG + Intergenic
931628264 2:64276515-64276537 GGAAACAGCTTGGAAAGGACTGG - Intergenic
932654911 2:73601994-73602016 AGCTGCAGCTTGGAAACCGCAGG - Intronic
932663054 2:73673608-73673630 AGCTGCAGCTTGGAACCCACAGG - Intergenic
935299306 2:101680021-101680043 TGATGCAGCTTTACAACCACTGG - Intergenic
937721129 2:125097963-125097985 TAAAGGAGCTTGTAAACTACAGG + Intergenic
938403849 2:131016223-131016245 TGATGATGCTGGGAAACCACAGG - Intronic
939157332 2:138541063-138541085 TGAAGCAGCTTTGCAACCCAGGG + Intronic
940049793 2:149450177-149450199 TGCTGAAGCTTGAAAACCACTGG - Intronic
942979022 2:182056306-182056328 ATAAGCAGGTTGGAAACCATGGG - Intronic
1169427701 20:5509618-5509640 TGAAGCAGCCTGGTGACCCCAGG + Intergenic
1170381500 20:15764802-15764824 AGAGGGTGCTTGGAAACCACTGG - Intronic
1171272621 20:23828458-23828480 TGAAGCAACTTGGGGGCCACTGG - Intergenic
1174913315 20:54630093-54630115 GGAAGCTGTTTGGAAACGACTGG + Intronic
1177514675 21:22133781-22133803 TGAAGCAGCTAAGAAAACATGGG + Intergenic
1182956805 22:34434345-34434367 TGGAAAAGCTTGGAAAGCACAGG - Intergenic
1184892280 22:47387366-47387388 AGAAGAAACTTGGGAACCACCGG + Intergenic
949409419 3:3747881-3747903 TAAAAAAGCTTGAAAACCACTGG - Intronic
949421725 3:3873051-3873073 TTTAGCAGCATGGAAACCATTGG - Intronic
950199948 3:11035702-11035724 TGAAGAAACTGGGGAACCACAGG + Intronic
952928476 3:38340645-38340667 TGGTGCAGTTTGGGAACCACAGG + Intergenic
954616121 3:51969522-51969544 TGAAGCAGCTGCCCAACCACCGG - Exonic
954666331 3:52254890-52254912 GGAGGCAGCTTTGCAACCACAGG + Exonic
956904474 3:73751533-73751555 TCAAGCAGCTTGGAAATTTCTGG - Intergenic
959839376 3:110956577-110956599 GGAACAAGTTTGGAAACCACTGG - Intergenic
961544115 3:127620191-127620213 TAAAGCAGCTTGCAAGCCATGGG + Intronic
961661149 3:128469464-128469486 TGAAGCAACTTGGAACTCAGAGG - Intergenic
962066978 3:131991828-131991850 TGAAGCAGCTTGGACATGGCAGG - Intronic
962531966 3:136290558-136290580 TGAACCAGCCTGGGAAACACAGG - Intronic
963139850 3:141938178-141938200 GGCAGCCGCTTGGAAACCCCGGG - Intergenic
964798370 3:160524918-160524940 TGAAGCAGCTTGTCCAACACTGG + Intronic
964894763 3:161582308-161582330 TCAAGCAGTTTGGAAGCCAATGG + Intergenic
965172806 3:165289828-165289850 TGCAGCAACATGGATACCACTGG - Intergenic
965787526 3:172351800-172351822 TGAAGGAGGAGGGAAACCACAGG + Intronic
966366640 3:179195123-179195145 GGAAGCAGCTGGGAAAGCACCGG + Intronic
966557684 3:181282319-181282341 TCAATAAGCTTGGAAACCAATGG - Intergenic
966642409 3:182205315-182205337 GGAAGCAGCCAGGAAACCTCTGG + Intergenic
967986448 3:195098864-195098886 TGAGGCAGCTTGGAGACCCCAGG - Intronic
973949025 4:55991657-55991679 TGAAACAGGAAGGAAACCACTGG - Intronic
974119341 4:57619992-57620014 TTAAGAAGTCTGGAAACCACAGG - Intergenic
974600262 4:64070699-64070721 TGGAGCAGTTTGGAAAGCTCAGG + Intergenic
975173350 4:71258848-71258870 TGCAGCTGCTTGTTAACCACAGG + Intronic
977408234 4:96628278-96628300 TAAAGCAGCTTGGCAGCCAATGG - Intergenic
977800529 4:101224835-101224857 TGAAGGAGGTGAGAAACCACTGG - Intronic
978391512 4:108231101-108231123 TGAAGCAGCATGGAAAGAGCTGG - Intergenic
978642018 4:110881986-110882008 TGACACAGCTGGGAGACCACAGG - Intergenic
979634101 4:122937760-122937782 TGGAGCAGGTTTGAAACCAAAGG - Intronic
980240186 4:130162973-130162995 TGAAGCATATTGGAAAATACTGG + Intergenic
980503512 4:133685834-133685856 TTAAGCAGCCAGGAAACAACAGG - Intergenic
980626839 4:135383927-135383949 TGAAGTAACTTGGAAACCCCTGG + Intergenic
981139230 4:141249154-141249176 TGTGGCAGCATGGAGACCACTGG - Intergenic
981361481 4:143850676-143850698 TGAGGCAGCTTGGAAAGGTCAGG + Intergenic
982713475 4:158782208-158782230 TGGAGCAGCTTGCTAAACACAGG + Intronic
983139595 4:164133253-164133275 TAGAGCAGCTGGGCAACCACAGG - Intronic
983676917 4:170305490-170305512 TGTTGCAGCCTGGAAACTACTGG - Intergenic
986033240 5:3912921-3912943 TGGACCAGTTTGGCAACCACTGG + Intergenic
987645629 5:20668803-20668825 TGAAGCAGCTGAGAAATCATGGG - Intergenic
989220558 5:38957040-38957062 CGAAGCATCTTGGAAACCCATGG - Intronic
992261551 5:74975648-74975670 TGAAGCAGCCTGGATAACTCGGG + Intergenic
992850020 5:80797675-80797697 TGAAAAAGGTTGGAAAGCACTGG - Intronic
999001643 5:147930126-147930148 TGAAGCAGCATGGAGAAAACCGG - Intergenic
999307166 5:150527098-150527120 AGAGGCAGTTTGGAAACCCCAGG + Intronic
999735971 5:154513435-154513457 GGAAGCAACTTGGAAATCATGGG - Intergenic
999793163 5:154962211-154962233 AGAAGCAGCTTGGCAAATACAGG - Intronic
1000883240 5:166720987-166721009 TGAAGCAAGTGTGAAACCACAGG - Intergenic
1001406075 5:171478583-171478605 TCAAGCAGCTTCCAACCCACTGG - Intergenic
1001409353 5:171499310-171499332 CGCAGCAGCTGGGAAACCCCTGG + Intergenic
1002468110 5:179417892-179417914 AGAAGCAGCTGGGTGACCACGGG + Intergenic
1002667590 5:180837153-180837175 TGAAACAGCTTGCAAAGCATTGG + Intergenic
1004275613 6:14232960-14232982 TGAAACTGCCTGGAAACCAGAGG - Intergenic
1005410452 6:25539677-25539699 TTAAGCAGCTTTGAAACCACAGG - Intronic
1006782581 6:36642261-36642283 TGAAGGAAATTGGAAAACACTGG - Intergenic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1011030211 6:82914436-82914458 TGTGGCACCTTGGAAACCACTGG - Intronic
1012614116 6:101254214-101254236 AGAAGCAGCGTGAAAACCATTGG + Intergenic
1015239413 6:131006928-131006950 TTAAGCAGCTTGGATCCCATGGG + Intronic
1016159309 6:140858325-140858347 TGATGCAGCTTGGAGACCTTAGG + Intergenic
1017097014 6:150813429-150813451 CTCAGCAGCTTGGAAACTACTGG + Intronic
1017102110 6:150857981-150858003 AGAAGGAGCCTGGAAACCAAAGG - Intergenic
1017906933 6:158763153-158763175 TGAAGCAGGGTGGGAACCACAGG - Intronic
1017976103 6:159358758-159358780 TGAAGCAGTTTGGAAATCACTGG + Intergenic
1019352960 7:563487-563509 TGAAGCAGCTTGGGGCCCCCTGG - Intronic
1021258097 7:18419678-18419700 TGAAGAGGGTTGGAAACCAAAGG + Intronic
1021621245 7:22552839-22552861 TGCAGCAACTTGGAATCCCCTGG + Intronic
1023472194 7:40535707-40535729 TGAAGCAACATGGATACAACAGG + Intronic
1025757989 7:64363217-64363239 GGAAGCTGCTTGGACACCAATGG - Intergenic
1027304759 7:76882067-76882089 TGAAGCAACTTGGAAAACCATGG + Intergenic
1027775499 7:82459459-82459481 TGATGCAGCTTGAAAAAGACTGG + Intergenic
1030426662 7:109387184-109387206 TGAAGCAGGTTGCAGTCCACAGG + Intergenic
1033952622 7:146803907-146803929 TGAAGCACCTTTGAAATCAAAGG - Intronic
1036288029 8:7462065-7462087 AGAAGCATCTTGGAAACTACAGG + Intronic
1036333447 8:7849463-7849485 AGAAGCATCTTGGAAACTACAGG - Intronic
1037444091 8:18947240-18947262 AGAAACAGCATGGAAACCAAAGG + Intronic
1038019334 8:23539601-23539623 TTAACCAGCTTGGAAACCTTGGG + Intronic
1039859449 8:41444467-41444489 TGAAGCTGCTTGCCAAGCACTGG + Intergenic
1041318580 8:56590449-56590471 AGGAGCAGCTTGGAAACTACAGG - Intergenic
1041394788 8:57379275-57379297 TGATGCAGATAGAAAACCACAGG + Intergenic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1045389689 8:101703213-101703235 TGAAAAAACTTAGAAACCACTGG - Intronic
1046885495 8:119362486-119362508 TGAAGCAGCTTGTGAAACGCAGG + Intergenic
1047933140 8:129750234-129750256 TGAGGCTGCTTGGAATCCCCTGG - Intronic
1047940644 8:129824958-129824980 AGCAGCAGATTGGAAACCCCAGG + Intergenic
1049809980 8:144562249-144562271 TGGAGCACGATGGAAACCACTGG - Intronic
1049809983 8:144562269-144562291 TGGAGCACGATGGAAACCACTGG - Intronic
1050819371 9:9858364-9858386 TGAAGCAGGTTTGAAGTCACAGG - Intronic
1052740465 9:32387298-32387320 TAAACCAGCTCTGAAACCACTGG - Intronic
1052807011 9:33022579-33022601 TGCAGCAGTTTGTAAAACACTGG + Intronic
1055124082 9:72698941-72698963 TGAAGCAGAGAGGAAGCCACAGG + Intronic
1055301741 9:74889793-74889815 TGATACAGCTTGGGAACCAAAGG - Intergenic
1055681911 9:78724383-78724405 TGCAGCAGCTTGGATCCCAGTGG - Intergenic
1055887657 9:81083261-81083283 TGAAGCAGCGTGGAAAGCACTGG - Intergenic
1056032085 9:82563389-82563411 TGAATGAGATGGGAAACCACTGG - Intergenic
1056235237 9:84587860-84587882 TGTGGCAGCTTGGAAACCAGGGG + Intergenic
1056483697 9:87032766-87032788 TGAAACATTTTGAAAACCACTGG + Intergenic
1057416481 9:94868218-94868240 TAAAGCAGCTTGGAGGCCACAGG + Intronic
1059430700 9:114248566-114248588 AGAAGCAGCTTGGAAAGCTGCGG - Intronic
1059488100 9:114643098-114643120 GGAAGCAGATTGAATACCACAGG - Intronic
1059862559 9:118481201-118481223 TGATGCAGGTTGGAAACCTGTGG + Intergenic
1061149894 9:128822716-128822738 TGAAGCAGCAGTGAAACCAGGGG - Exonic
1061349476 9:130053458-130053480 TGAAGCGCCTAGAAAACCACAGG + Exonic
1061361328 9:130144190-130144212 TGAAGGACCTGGAAAACCACAGG - Intergenic
1061429536 9:130522576-130522598 TGAAGCAGCTGTGAAACAAGAGG + Intergenic
1061684407 9:132263232-132263254 CCAGGCAGCTTGGGAACCACTGG - Exonic
1062021645 9:134322329-134322351 GGAGGCAGCTTGGAAAGCTCAGG + Intronic
1186438716 X:9566450-9566472 TGAAGCGGTTTGGAATCCTCTGG + Intronic
1188872254 X:35387552-35387574 TAAGGCAGCTTGGAAACTAAAGG - Intergenic
1191094200 X:56657737-56657759 GGAAGCAAATTGGAAAACACAGG - Intergenic
1192966182 X:76179610-76179632 TGAACCAGCCTTGCAACCACAGG + Intergenic
1198109592 X:133491409-133491431 TGGAGCAGTTTGAAAACCTCTGG - Intergenic
1198326824 X:135582695-135582717 TCAAGAAACTTGGAAAACACTGG + Intergenic
1199833674 X:151567376-151567398 TGAAGCATCTAGGAAGCCACTGG + Intronic
1201207656 Y:11648109-11648131 TGAAACAAAATGGAAACCACCGG + Intergenic
1201485973 Y:14495075-14495097 TGAAGCAGCCTGCTATCCACAGG - Intergenic