ID: 1098126806

View in Genome Browser
Species Human (GRCh38)
Location 12:67305012-67305034
Sequence GGGAACATTAGCAGTACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098126806 Original CRISPR GGGAACATTAGCAGTACTAT AGG Intronic
905404694 1:37724946-37724968 GGGAACATTAGGAGTAATAGTGG + Intronic
908902438 1:68971108-68971130 GAGATTATTAGAAGTACTATGGG - Intergenic
910494432 1:87810603-87810625 GGAAACATTAGCAGGACAGTGGG - Intergenic
911791156 1:102016512-102016534 GAGAAAATTAGGAGTACTCTTGG + Intergenic
918563695 1:185900344-185900366 GGTAACATTAGCAATAATATAGG - Intronic
920435894 1:205946950-205946972 GGGAACCTTAGGAATACTTTGGG - Intergenic
1063346151 10:5313925-5313947 GGGAACATCAACAGTACTGGTGG + Intergenic
1064618504 10:17190223-17190245 TGGAACATTATCAGAAATATTGG - Intronic
1064816277 10:19267586-19267608 GGGAACAGTGTCAATACTATTGG + Intronic
1067028420 10:42864270-42864292 GGGAAAATTAGCTGTGCTAAAGG - Intergenic
1069559296 10:69418321-69418343 GGCAACAGTAGCAGTACTTTAGG + Intergenic
1071860415 10:89666674-89666696 GGAAACATTTGCAGTAATCTAGG + Intergenic
1075544687 10:123346253-123346275 GGGCACAGTAGAAGTACTTTAGG - Intergenic
1079454535 11:20625227-20625249 GGTAACATTAGCAGAACTTGGGG - Intronic
1080269864 11:30439932-30439954 GGCAGAATTAGCAGTAATATAGG + Intronic
1080314880 11:30937224-30937246 GGGAAAATTAGCAGTATCAGGGG - Intronic
1081293325 11:41353460-41353482 GGGAATATTTTCAGTAGTATTGG - Intronic
1083332045 11:61903232-61903254 GGGCACAGCAGCAGTACTTTTGG + Intronic
1088063441 11:105685745-105685767 GGGTATATTAGCAGGATTATAGG + Intronic
1088101227 11:106158553-106158575 GGCAACATAAGCAGCACCATTGG + Intergenic
1089336412 11:117726852-117726874 GGGAGCATAAGCAGCTCTATAGG + Intronic
1090600088 11:128361198-128361220 AGAAACATTAGCACTACTGTTGG + Intergenic
1090808747 11:130219076-130219098 GGGAACATGGTCACTACTATGGG + Intergenic
1097130418 12:56807085-56807107 TGGAAAAATAGCAGTACCATTGG - Intergenic
1098126806 12:67305012-67305034 GGGAACATTAGCAGTACTATAGG + Intronic
1106620547 13:31367130-31367152 TGGAAGAATAGCAGTACCATTGG + Intergenic
1109905936 13:68841885-68841907 TGGAACATTTTCAGTAGTATTGG - Intergenic
1111275269 13:85938563-85938585 GGAAGAATTAGCAGTACCATGGG + Intergenic
1115142363 14:30187005-30187027 GAGAACATTTGAAGTTCTATTGG + Intronic
1116131096 14:40856248-40856270 GGAAAAATAGGCAGTACTATTGG + Intergenic
1117020520 14:51565723-51565745 GGGAACAGCAGCAGTTCTAGAGG + Intronic
1119584725 14:75822663-75822685 GGGAACAATAGCAACACCATAGG - Intronic
1132091078 15:98948381-98948403 GGGAACATTAGCAGCAACAGAGG + Intronic
1141335627 16:83152632-83152654 GGAAACCTTAGCAATAATATGGG + Intronic
1153428297 18:4989534-4989556 TGGAAGAATAGCAGTACCATTGG - Intergenic
1158255248 18:55539163-55539185 GGAAACATTAGCAGATCTATGGG + Intronic
1159157136 18:64599529-64599551 GGGAACATCAGCAATTCTCTGGG - Intergenic
1162856824 19:13475018-13475040 AGGAAAATTAGAAGCACTATAGG + Intronic
924964137 2:59818-59840 TGGAATAATAGCAGTACCATTGG + Intergenic
925939381 2:8801415-8801437 GGGAACATTGGCATTAACATGGG + Intronic
927925209 2:27007716-27007738 GGGAACATTAACAGTATACTTGG - Intronic
928204023 2:29271427-29271449 GGGCACATTAGCAGTGCCATGGG + Intronic
930306120 2:49676860-49676882 AGAAACATTAGCAGTACTCAAGG + Intergenic
938127637 2:128686060-128686082 GGGAACATCAGCAGAACCTTGGG - Intergenic
945989814 2:216386192-216386214 GAGAAGATTTGCAGTTCTATTGG + Intergenic
946083561 2:217148923-217148945 GGGAACATTAGCTTGAATATAGG + Intergenic
1169761521 20:9100249-9100271 GGGAACAAAAGCAATACTAATGG + Intronic
1171342720 20:24443317-24443339 GGGAAGATGAGCAGGACTCTTGG + Intergenic
1175538378 20:59731584-59731606 GCGACCATTGGCAGTACTATAGG + Intronic
1175639372 20:60614697-60614719 GGGAACAATAGTAGTCCTAAAGG - Intergenic
1177333083 21:19685982-19686004 TGGAACCTTAGCAGAACTAGGGG - Intergenic
1177466256 21:21485123-21485145 GGGAAAATAAGCAGCACAATTGG - Intronic
1177992627 21:28057188-28057210 AGGCAAATTAGCAGTAGTATAGG + Intergenic
949586298 3:5441637-5441659 GGTAAGAATAGCAGTCCTATTGG + Intergenic
951074566 3:18374153-18374175 GGAGACATTAGCAGCACTGTAGG - Intronic
951485046 3:23202286-23202308 GGGAACAGTAGCAGTGCTGTAGG - Intergenic
951539415 3:23767972-23767994 GGCATCATTAGCAGCTCTATGGG - Intergenic
952593380 3:34985354-34985376 GGGAACCTCTGCAGTACTCTAGG - Intergenic
956557736 3:70541059-70541081 TGGAAAAGTAGCAGTACCATTGG - Intergenic
957007181 3:74963208-74963230 GGGAAAATTAGCAGGACAATAGG - Intergenic
957607864 3:82427693-82427715 GGGAACATTAGCAATTGAATTGG + Intergenic
958801087 3:98756706-98756728 GGTTACATTAGCAGTCTTATAGG - Intronic
959416514 3:106082102-106082124 GAGAAGATTAGCAGTATTATAGG - Intergenic
962452041 3:135528087-135528109 GGAAACATTAGCAGTGGTTTTGG + Intergenic
963788244 3:149557026-149557048 GGGAACACTAGGAGTTTTATGGG - Intronic
964335269 3:155648206-155648228 GGGAACAATAGTAGTAGTATTGG + Intronic
965100157 3:164287275-164287297 GGGAACATAAGCACAATTATGGG - Intergenic
965860773 3:173146984-173147006 GGGAACATCTGCAGTAGTCTGGG - Intergenic
966627425 3:182033418-182033440 GGGAAGATTTGAAGTAGTATGGG - Intergenic
975219532 4:71798173-71798195 GGGAACATCAGCAGCAAAATAGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976702387 4:87985459-87985481 GAGAACATTAACAATACCATGGG + Intergenic
977097548 4:92765672-92765694 AGGTACATTAGCAGTGCCATAGG - Intronic
983162184 4:164430038-164430060 GGGAACAGTAGCAGTAGTTGCGG + Intergenic
988234290 5:28520866-28520888 GGGAACATTTTCAGTAGGATTGG - Intergenic
991165929 5:63565521-63565543 TGGAAGAATAGCAGTACCATTGG + Intergenic
991772312 5:70051448-70051470 GGAAACATTAGCGGTTCTTTTGG + Intronic
991851605 5:70926866-70926888 GGAAACATTAGCGGTTCTTTTGG + Intronic
998636261 5:143958288-143958310 GGGAACATTTGCAGTCTTTTAGG + Intergenic
1008333472 6:50271423-50271445 TGGAAGATTAGCAGTAACATTGG - Intergenic
1009702910 6:67206261-67206283 GGGAACATTTTCAGTAGGATTGG - Intergenic
1014683113 6:124458659-124458681 GGTAACATGAGCAGAATTATAGG + Intronic
1014835679 6:126157565-126157587 GGGAAGATAAGGAGAACTATAGG + Intergenic
1016167877 6:140970444-140970466 GGGAACATTAGCTGAAAAATGGG + Intergenic
1019736210 7:2650985-2651007 GGGACCATAAGCTGTACTGTGGG + Intronic
1023725646 7:43140674-43140696 GGGAGCATTTGCATTACTTTGGG - Intronic
1025518519 7:61687496-61687518 GGGGACATTGGCAGTGCTTTGGG - Intergenic
1025542844 7:62116143-62116165 GGGGACATTGGCAGTGCTTTGGG - Intergenic
1026386385 7:69852792-69852814 GGGGACACAAGCAGTACTAACGG - Intronic
1030719312 7:112850454-112850476 GGGAACAGTATCAGTAAGATTGG + Intronic
1030790044 7:113714012-113714034 GGGAGAATTTGCAGTTCTATTGG - Intergenic
1032617594 7:133491722-133491744 GTGAATATTAGAAGTACTTTGGG + Intronic
1033868786 7:145724061-145724083 AGGAACATTAGCAGCTCAATAGG + Intergenic
1040008233 8:42639014-42639036 GGGAACATTTCCAGTACTTGTGG + Intergenic
1044008443 8:86964338-86964360 TGGAAGAATAGCAGTACCATTGG - Intronic
1045630320 8:104111759-104111781 GGAAACATTAGCTGTAATAAAGG + Intronic
1053615528 9:39761722-39761744 GGAAACATTAGGAGTGCCATCGG + Intergenic
1053873694 9:42520985-42521007 GGAAACATTAGGAGTGCCATCGG + Intergenic
1053898930 9:42773562-42773584 GGAAACATTAGGAGTGCCATCGG - Intergenic
1054237992 9:62580669-62580691 GGAAACATTAGGAGTGCCATCGG - Intergenic
1054262591 9:62882656-62882678 GGAAACATTAGGAGTGCCATCGG + Intergenic
1054268638 9:62945771-62945793 GGAAACATTAGGAGTGCCATCGG - Intergenic
1054552123 9:66615179-66615201 GGAAACATTAGGAGTGCCATCGG - Intergenic
1055330168 9:75175540-75175562 GGGAACTTTAGCAGCCCTGTGGG + Intergenic
1059565752 9:115381819-115381841 TGGAAGAATAGCAGTACCATTGG + Intronic
1060781901 9:126419088-126419110 AGGAGCATTAGCAGAACTTTGGG - Intronic
1192588476 X:72339781-72339803 GGGAACAATTGCAGTACCAAGGG + Intronic
1193140746 X:78024326-78024348 GAGAACATTAGTAGTTTTATAGG + Intronic
1193167834 X:78302217-78302239 GGGAACATTGACAGTAGTCTGGG - Intronic
1194010539 X:88555028-88555050 GGGAACAATAACACTACGATAGG - Intergenic
1194124051 X:89992045-89992067 GGGAAGAATAGCAGTACCAGTGG - Intergenic
1199005769 X:142694056-142694078 GGGAACATTGGCAGTAGCCTTGG + Intergenic
1200476939 Y:3649667-3649689 GGGAAGAATAGCAGTACCAGTGG - Intergenic