ID: 1098126985

View in Genome Browser
Species Human (GRCh38)
Location 12:67307271-67307293
Sequence GAATTCTCCTTGGCCAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098126985_1098126991 12 Left 1098126985 12:67307271-67307293 CCCTTCTTGGCCAAGGAGAATTC 0: 1
1: 0
2: 4
3: 31
4: 296
Right 1098126991 12:67307306-67307328 GACACTGGTGTTATTTGGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 122
1098126985_1098126990 7 Left 1098126985 12:67307271-67307293 CCCTTCTTGGCCAAGGAGAATTC 0: 1
1: 0
2: 4
3: 31
4: 296
Right 1098126990 12:67307301-67307323 TTGAAGACACTGGTGTTATTTGG 0: 1
1: 0
2: 1
3: 13
4: 185
1098126985_1098126989 -3 Left 1098126985 12:67307271-67307293 CCCTTCTTGGCCAAGGAGAATTC 0: 1
1: 0
2: 4
3: 31
4: 296
Right 1098126989 12:67307291-67307313 TTCTAAGGCATTGAAGACACTGG 0: 1
1: 0
2: 0
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098126985 Original CRISPR GAATTCTCCTTGGCCAAGAA GGG (reversed) Intronic
900285465 1:1897323-1897345 AAATGCTCCTTGGCCAGGCACGG - Intergenic
900405727 1:2492159-2492181 GACTTCTCCCTGGCCAAGTGAGG + Intronic
902113683 1:14103796-14103818 GAATTCCCCTTTGCCATGTAAGG + Intergenic
903400483 1:23042338-23042360 GAATTTTATTTGGGCAAGAAAGG - Intronic
904248729 1:29206970-29206992 GGATGCTTCTTGGCCAAGGAGGG - Intronic
905333645 1:37227723-37227745 TAATTCTTATTGGCCAGGAATGG - Intergenic
906804441 1:48766694-48766716 GAAATCCCCCTGGCCAAGCATGG - Intronic
906840410 1:49132459-49132481 TAATTCTCCTTGTCCACTAAAGG - Intronic
909810807 1:79930158-79930180 GAAGTCTCCTTGGAGAAGGATGG - Intergenic
910433293 1:87179778-87179800 GAGCTCTCCTTTACCAAGAAAGG - Intergenic
910497906 1:87853365-87853387 GGAGTCCCCTTGGCCAAGACAGG + Intergenic
911303813 1:96208433-96208455 GAATTCTCCTTCGCAGGGAAGGG - Intergenic
911980259 1:104558192-104558214 GAAGTCTACTTGGGGAAGAATGG - Intergenic
912014725 1:105018428-105018450 GTGGTCTCCTTGGCCAAGAGGGG - Intergenic
912939539 1:114032769-114032791 GAATTCTACCTTGCCAACAATGG + Intergenic
913478310 1:119260344-119260366 TAATTCCCTTTTGCCAAGAAAGG + Intergenic
915818523 1:158996122-158996144 GGGGTCCCCTTGGCCAAGAAGGG + Intergenic
918163968 1:181926740-181926762 GGAGTCTTCTTGGCCAAGAGGGG - Intergenic
918349280 1:183636395-183636417 GACTTCCCGCTGGCCAAGAAGGG - Exonic
919078404 1:192839959-192839981 GGAATCCCCTTGGCCAAGAGAGG + Intergenic
920011008 1:202867651-202867673 AAATTCTCTTTGGCCAAGAGGGG + Intergenic
920555775 1:206903173-206903195 CAATAATCCTGGGCCAAGAATGG - Exonic
922700222 1:227754972-227754994 GGAATCCCCTTGGCCAAGATGGG - Intronic
922940932 1:229465029-229465051 GAAATCTCCTTGGAGAAGATGGG - Intronic
922995068 1:229950489-229950511 GAATACTACTTGGCCATTAAAGG - Intergenic
924421360 1:243913134-243913156 CTATTCTCCTTGACCAAGCATGG - Intergenic
924702641 1:246469283-246469305 CAATTCCCCTTGGCCGAAAAAGG + Intronic
1063254336 10:4309459-4309481 GGAGTCCCCTTGGCCAAGAGGGG + Intergenic
1063278883 10:4602611-4602633 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1064462763 10:15551020-15551042 GAATGCTCTTTGGAGAAGAATGG + Intronic
1064879926 10:20039992-20040014 GAGGTCCTCTTGGCCAAGAAAGG - Intronic
1064988176 10:21231844-21231866 GAAGTGTCCTTGGCCAAGAGGGG - Intergenic
1065007339 10:21392131-21392153 GGAGTCTCCTTGACTAAGAAGGG - Intergenic
1065009229 10:21406558-21406580 GGAATCCCCTTGGCCAAGAGGGG + Intergenic
1065180184 10:23117047-23117069 GGAGTCCTCTTGGCCAAGAAGGG + Intronic
1068447007 10:57137197-57137219 GAAGTCTCCTTGGTGAAGGAAGG - Intergenic
1069407854 10:68121632-68121654 TAATTCTTCTTGGCTCAGAAAGG - Exonic
1070632226 10:78094870-78094892 GAATTCCCCTTGCCTCAGAATGG + Intergenic
1071024849 10:81100149-81100171 GATTTCTTCTTGGCAGAGAAGGG + Intergenic
1071402724 10:85292393-85292415 AAGTTTTCATTGGCCAAGAATGG - Intergenic
1071546448 10:86533563-86533585 GAATGCTGCTTGCCCAAGCAAGG + Intergenic
1075223924 10:120608438-120608460 GTATTCTCATTGGCCAGGCAGGG - Intergenic
1076322698 10:129595193-129595215 GAATTCTCCTCGGCACAGGAGGG + Intronic
1076382012 10:130029989-130030011 TAATTCTCCTTTCCCATGAAAGG + Intergenic
1076430198 10:130396404-130396426 GAGGTCCCCTTGGCCAAGAGTGG - Intergenic
1076708028 10:132312710-132312732 GGAGTTTCCTTGGCCAAGAGCGG - Intronic
1079928644 11:26528998-26529020 GATTTTTCCTTTGCCAAGTAAGG - Intronic
1081158486 11:39724501-39724523 GAATTCCCCTTGGCTCAGAGGGG + Intergenic
1082846165 11:57727419-57727441 GAATGCTTTTTGGCCAAGAGAGG + Intronic
1083447913 11:62722337-62722359 GAACTTTCCTTCTCCAAGAATGG - Exonic
1084365440 11:68694514-68694536 GGGGTCTCCTTGGCCAAGAGAGG - Intergenic
1084643530 11:70440500-70440522 TAATTCTCCTTGGCCATGCGGGG - Intergenic
1084877813 11:72146522-72146544 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1084883113 11:72186178-72186200 GGGGTCTCCTTGGCCAAGATGGG - Intergenic
1085489657 11:76903481-76903503 GGATTCCCCTTGGCCATAAAAGG - Intronic
1086947390 11:92856586-92856608 GAATTATCCTTGGCAAGGGAAGG - Intronic
1088194312 11:107258363-107258385 GGGTTCTCCTTGGCCAGGAGAGG + Intergenic
1090209862 11:124911177-124911199 GAGTTCTCCTTGGGGAAGGATGG + Intergenic
1091899021 12:4128590-4128612 GATTCCTCGTTGGTCAAGAATGG + Intergenic
1093590879 12:20900973-20900995 GAATTTTTCTTAGGCAAGAATGG - Intronic
1093771634 12:23024518-23024540 ATATTCTCCTTAGCTAAGAAAGG - Intergenic
1098126985 12:67307271-67307293 GAATTCTCCTTGGCCAAGAAGGG - Intronic
1098267695 12:68739065-68739087 GAATGCTCCTTCGCCAAGATAGG + Intronic
1098546877 12:71721397-71721419 GGGTTCTCCTTGGCCAAGAGGGG - Intergenic
1098730862 12:74035937-74035959 GAGATCTCCTTGGGGAAGAATGG - Intergenic
1098832102 12:75375447-75375469 GAGTTCTCCTTGGAGAAGGATGG + Intronic
1099315788 12:81080560-81080582 GAATTCTGGTTGGGCAAGCAGGG + Intronic
1099577910 12:84404037-84404059 GAGTTCTCCTTGGAGACGAATGG - Intergenic
1099579327 12:84422870-84422892 AAAATCTTCTTGGCCAACAAAGG + Intergenic
1099865826 12:88279458-88279480 GGGTTCTCCTTGGCCAACAGGGG - Intergenic
1100727376 12:97423062-97423084 GAGGTCCCCTTGGCCAAGAGGGG - Intergenic
1101088388 12:101259467-101259489 GAGGTCTTCTTGGCCAAGAGGGG + Intergenic
1101920956 12:108932605-108932627 GGGGTCCCCTTGGCCAAGAAGGG - Intronic
1102444428 12:112990914-112990936 GGGTTCCCCTTGGCCAAGAGAGG + Intronic
1103478860 12:121238087-121238109 GCATTCTCCTTGTTCCAGAAAGG + Exonic
1104408363 12:128537456-128537478 GGCATCTCCTTGGCCAAGAGAGG + Intronic
1105769965 13:23599875-23599897 GGAATGTCCTTGGCCAAGAGGGG + Intronic
1106019462 13:25900676-25900698 AAGGTCTCCTTGGCCAAGAGGGG + Intronic
1106145109 13:27043393-27043415 GAATTTTCCTTGGCTGGGAAAGG - Intergenic
1107571695 13:41666903-41666925 GAATCTTTCTTGGCCCAGAAAGG - Intronic
1107979199 13:45718164-45718186 CAGGTCTCCTTAGCCAAGAAGGG - Intergenic
1108883242 13:55147408-55147430 GGGATCACCTTGGCCAAGAAGGG - Intergenic
1108920105 13:55662326-55662348 GGGGTCTCCTTGGCCAAAAAGGG + Intergenic
1108990235 13:56646674-56646696 GAATTTTCCCTGGGAAAGAAAGG - Intergenic
1109827128 13:67736498-67736520 CACTTTTCTTTGGCCAAGAAAGG + Intergenic
1110928364 13:81184492-81184514 GCAATCTCCTTGGCCAAGAAGGG - Intergenic
1111406534 13:87813817-87813839 GAACTCTCCTGTTCCAAGAAGGG + Intergenic
1111440896 13:88281715-88281737 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
1111788697 13:92824954-92824976 TATTTCACCTTGGACAAGAATGG - Intronic
1112792876 13:103022552-103022574 GAGGTCTCCTTGGCCAGAAATGG - Intergenic
1114758460 14:25285284-25285306 GAAGTCTCCTTGGGGAAGGATGG + Intergenic
1115573500 14:34689164-34689186 GTATAATCCTTGGCCAATAATGG - Intergenic
1116161118 14:41267932-41267954 GAATTCTACTTAGCCAAGATGGG - Intergenic
1116475817 14:45338003-45338025 GGAGTCTCCTTGGCCAAGAAGGG + Intergenic
1117470924 14:56043771-56043793 TGATTCTCCCTGGGCAAGAAAGG + Intergenic
1118464774 14:66021087-66021109 GGAATCTCCTTGGCCAAGAGAGG + Intergenic
1118733313 14:68684496-68684518 GGAGTCTTCTTGGCCCAGAATGG - Intronic
1121947459 14:98136853-98136875 GAATTCTGCTTTGCAAAAAAAGG - Intergenic
1122372432 14:101236016-101236038 GAGTCCTCATTGGCCCAGAAAGG - Intergenic
1122657121 14:103269593-103269615 GGGGTCCCCTTGGCCAAGAAGGG - Intergenic
1124652098 15:31482018-31482040 TCAGTGTCCTTGGCCAAGAACGG + Exonic
1124805471 15:32877512-32877534 TAATTCTCCTTGTTCATGAAGGG - Intronic
1126342181 15:47653059-47653081 CAGTTCTCCTTGGCTAGGAAAGG + Intronic
1126645081 15:50867751-50867773 GAATGCTTTTTGGCCAAGAAGGG - Intergenic
1127466945 15:59253441-59253463 GAAGTTTCCTTTGCCAAAAACGG + Intronic
1127580161 15:60330996-60331018 GAATTCCCACTGGCAAAGAATGG - Intergenic
1128172500 15:65525370-65525392 GGTGTCCCCTTGGCCAAGAAGGG + Intergenic
1129882153 15:79014394-79014416 GAATACTACTTGGCCATAAAAGG + Intronic
1129977341 15:79833194-79833216 CAATTGTCCTTGGCTAAGGAGGG - Intergenic
1133310845 16:4846173-4846195 ATATCCTCCTTGGCCAGGAAAGG - Exonic
1133587124 16:7206762-7206784 TATTTCTCCTTGGCCAGGACTGG - Intronic
1133872911 16:9706210-9706232 GGAGTCCCCTTGGCCAAGATGGG - Intergenic
1135226083 16:20659373-20659395 GAATGCTTTTTGGCCAAGAGCGG + Intronic
1136048380 16:27633180-27633202 GGGGTCCCCTTGGCCAAGAAGGG + Intronic
1137311659 16:47266855-47266877 AAATTCTATTTGGCCAAAAAAGG + Intronic
1139443534 16:66981722-66981744 CAGTTCACCTTGGCCAGGAACGG + Intergenic
1141032493 16:80601993-80602015 GGATTCTCCTTGGACATGGAAGG - Exonic
1141209169 16:81960032-81960054 GACTTCTCTTTGGCCACGCATGG - Exonic
1141341050 16:83204081-83204103 GAATGTTCCTGGGCCATGAATGG + Intronic
1142166105 16:88589462-88589484 GAATGCTACTTGGCCATAAAGGG + Intronic
1143995393 17:11002364-11002386 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1144285295 17:13768745-13768767 GAAGTCTCCCAGGCCAAGGAAGG - Intergenic
1144424243 17:15126508-15126530 GAATACTACTCAGCCAAGAAAGG + Intergenic
1145286504 17:21510085-21510107 GAGGTCCCCTTGGCCAAGAGGGG + Intergenic
1145391109 17:22456233-22456255 GAGGTCCCCTTGGCCAAGAGGGG - Intergenic
1146495680 17:33319919-33319941 GAGTTTTCCTAGACCAAGAAAGG - Intronic
1147025516 17:37579364-37579386 GAATTCTTCTTCATCAAGAAAGG + Intronic
1147611362 17:41803494-41803516 GAAGTCCCATTGGCCAGGAAGGG - Intronic
1148096999 17:45059392-45059414 GAGTGCTCCATGGCCAAAAAGGG - Intronic
1148122225 17:45220232-45220254 GAATTCTCCTTGGGCATGCAGGG - Intergenic
1153136243 18:1920662-1920684 GAATGCTTTTTGGCCAAGAGCGG - Intergenic
1153444260 18:5154588-5154610 GGGGTCCCCTTGGCCAAGAAGGG - Intronic
1154068271 18:11129676-11129698 GAGGTCTCCTTGGGGAAGAATGG - Intronic
1154505995 18:15041445-15041467 GAAGTCTCCTTGGGGAAGAATGG - Intergenic
1155209485 18:23588014-23588036 GAATTCTTCTTCCCCAAGGAGGG - Intergenic
1156192245 18:34733127-34733149 GAGGTCTCCTTGGGGAAGAATGG + Intronic
1158726792 18:59980880-59980902 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1158866267 18:61640299-61640321 GGAGTCCCCTTGGCCAAGAGGGG + Intergenic
1158885266 18:61820912-61820934 GCTTTCTCCCTGGCCAAGCAGGG + Intronic
1159831281 18:73280786-73280808 GATTTCCCCTTTGCAAAGAATGG - Intergenic
1160420554 18:78740995-78741017 GAATTCTCCAGGGCGAACAAAGG - Intergenic
1163041810 19:14608289-14608311 GATTTGTCATTGGCAAAGAAGGG + Intronic
1164430480 19:28183980-28184002 GGAATCCCCTTGGCCAAGAGAGG - Intergenic
1167505778 19:49870296-49870318 GCAATGTCCTAGGCCAAGAAGGG - Intronic
925312683 2:2897062-2897084 GAAGTCTGCTTTTCCAAGAATGG - Intergenic
928816236 2:35297841-35297863 GGGATCCCCTTGGCCAAGAAGGG + Intergenic
929270028 2:39962192-39962214 GAGTTCTCCTTGGGAAAGGATGG + Intergenic
930110695 2:47676214-47676236 GCCATCTCCTTGGCCAAGAGGGG - Intergenic
930781647 2:55229781-55229803 GAATTGTTCTTGGCCAGGCATGG + Intronic
931416869 2:62089816-62089838 GAATGCTTTTTGGCCAAGAGGGG - Intronic
933265916 2:80180138-80180160 GAGATCTCCTTGGGCAAGGATGG + Intronic
933582532 2:84143662-84143684 GGGGTCCCCTTGGCCAAGAAGGG - Intergenic
933917057 2:87006117-87006139 GATTTCTCCTTTTCCAGGAAAGG - Intronic
934005938 2:87763797-87763819 GATTTCTCCTTTTCCAGGAAAGG + Intronic
934074526 2:88416478-88416500 GCATCCTCCTTGGTCAAGGAAGG - Intergenic
935768894 2:106397897-106397919 GATTTCTCCTTTTCCAGGAAAGG + Intronic
935911208 2:107898027-107898049 GATTTCTCCTTTTCCAGGAAAGG - Intergenic
935969318 2:108514864-108514886 GATTTCTCCTTTTCCAGGAAAGG - Intergenic
936132981 2:109863069-109863091 GATTTCTCCTTTTCCAGGAAAGG - Intergenic
936211716 2:110508416-110508438 GATTTCTCCTTTTCCAGGAAAGG + Intergenic
936420855 2:112362993-112363015 GATTTCTCCTTTTCCAGGAAAGG + Intergenic
937255194 2:120550465-120550487 GAATTCTCCTTAGCACAGATGGG - Intergenic
937768505 2:125690379-125690401 CAATTCTCCTTTCCCAATAATGG + Intergenic
939287010 2:140144827-140144849 GAATACTCCTGGCCGAAGAAAGG - Intergenic
940472279 2:154114520-154114542 GAAGTCTCCTTGGGGAAGGATGG + Intronic
940546591 2:155096522-155096544 GAATTCTCCTTTGCCAGGTAAGG - Intergenic
942090832 2:172489127-172489149 GACTTGTCATTGGCCAAGCAGGG + Intronic
943877459 2:193089416-193089438 GAGATTTTCTTGGCCAAGAATGG + Intergenic
944498774 2:200335903-200335925 GAAGTCTCCTGAGCAAAGAATGG + Intronic
945957695 2:216101276-216101298 GAAGTCTCCTTGAACAGGAAGGG - Exonic
947060776 2:226162716-226162738 GAATTCTCATTGGCCAAGCCTGG + Intergenic
948846709 2:240686446-240686468 GGAATCCCCTTGGCCAAGAAGGG + Intergenic
948878612 2:240843651-240843673 GGAGTCTCCTTGGTCAAGAGGGG - Intergenic
1169300451 20:4437572-4437594 GAATTCTCTTTGGGGAATAAGGG + Intergenic
1169376736 20:5072438-5072460 GAGTTCTTCTTGGCCAACATGGG - Intronic
1170935106 20:20803133-20803155 GCAATCTCCTTGGCCAAGGGTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173378027 20:42507419-42507441 GAAGCCTTCTTGGCCGAGAAGGG + Intronic
1173563121 20:44020496-44020518 GAACTGCCCTTGGCCAAGAGGGG - Intronic
1175375134 20:58518940-58518962 GCAGCCTCCTGGGCCAAGAAGGG + Intergenic
1175469222 20:59214523-59214545 AATTTCTCCTTGGGCTAGAAGGG - Intronic
1176791859 21:13327581-13327603 GAAGTCTCCTTGGGGAAGAATGG + Intergenic
1177938008 21:27373809-27373831 AATTTCTTCTTGGCCATGAATGG + Intergenic
1178411118 21:32364563-32364585 GAACTATCCTAAGCCAAGAATGG + Intronic
1178779178 21:35584364-35584386 GAATTCTGGTGGGACAAGAAGGG - Intronic
1179569924 21:42272772-42272794 GAATTCTCCCTGGTGGAGAAGGG + Intronic
1184725671 22:46344133-46344155 TAATTCTCCTAGGACAAGATTGG + Intronic
1184936444 22:47727080-47727102 GTAATCTCCTTGGCCAAGAGGGG - Intergenic
949125862 3:444572-444594 GAAGTCTTCTTGGGGAAGAATGG + Intergenic
950420626 3:12896735-12896757 GAATTATGTTTGGCCAGGAAAGG + Intergenic
950532678 3:13561651-13561673 GCATGCTCCTTTGGCAAGAATGG - Intronic
951629439 3:24703112-24703134 TATTTATCCTTGGCCAAAAATGG - Intergenic
953378221 3:42446709-42446731 GAGATCCCCTTGGCCAAGAAGGG + Intergenic
953505800 3:43484770-43484792 GAGGTCTTCTTGGCCAAGAGAGG + Intronic
953576198 3:44114831-44114853 GAACTCTCCCTGGCCAAGAAAGG - Intergenic
955268126 3:57467730-57467752 GAATTCCTCTGGCCCAAGAAAGG - Intronic
955405840 3:58625167-58625189 GGGGTCTCCTTGGCCAAGAGGGG - Intronic
957724437 3:84046256-84046278 AAATTCCCATTGGCTAAGAATGG + Intergenic
958820923 3:98973007-98973029 GAATTCTCATTGGCCTAAATTGG - Intergenic
959203989 3:103282276-103282298 GACGTCTCCTTGGTGAAGAATGG + Intergenic
959781589 3:110240522-110240544 GTGGTCTCCTTGGCCAAGAAGGG + Intergenic
959794817 3:110413331-110413353 GACATCTCTTTGGCCGAGAATGG + Intergenic
960707837 3:120497704-120497726 GAACTCTACTTGGCCAACGATGG + Intergenic
960806289 3:121586806-121586828 GGAGTCTCATTGGCCATGAAAGG - Intergenic
962049230 3:131795355-131795377 GAGGTCCCCTTGGCCAAGAGGGG - Intronic
962469765 3:135695805-135695827 GATGGCTGCTTGGCCAAGAAAGG - Intergenic
962783220 3:138740992-138741014 GAATTCTCCGTGGTCAAGAGAGG - Intronic
962959818 3:140300423-140300445 GAATTCTCAATGCCAAAGAAAGG - Intronic
964199113 3:154098171-154098193 GCATCCTCCTTAGACAAGAAGGG - Intergenic
964765073 3:160171643-160171665 CAATTCTCCCTGGCCAAGGTAGG - Intergenic
965051550 3:163655538-163655560 GCGGTCTTCTTGGCCAAGAAGGG + Intergenic
970276236 4:14404139-14404161 GGGATCCCCTTGGCCAAGAAGGG + Intergenic
971060402 4:22962337-22962359 GAAATCTCCTGGGCCGAGATAGG - Intergenic
971759558 4:30747723-30747745 TAATTCTCCTTTGCCATGTAAGG + Intronic
971979479 4:33734281-33734303 GAAGTTTCCTTGGGGAAGAATGG + Intergenic
972302638 4:37799409-37799431 GGAGTTTCCTTGGCCAAGAGGGG - Intergenic
972746016 4:41933639-41933661 GGGGTCCCCTTGGCCAAGAAAGG + Intergenic
973610744 4:52634216-52634238 CAATTCTCCTGGGCCAGGCATGG + Intronic
974162806 4:58161825-58161847 GAATTCTTCTTCCCAAAGAAAGG - Intergenic
974442386 4:61936821-61936843 TATTTCTCTTTTGCCAAGAAAGG + Intronic
974627114 4:64440126-64440148 GAATGCTTTTTGGCCAAGAGGGG - Intergenic
974764242 4:66321330-66321352 GAATTCTGCTTGGCGCAGAGGGG + Intergenic
976885430 4:89978017-89978039 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
978026133 4:103877126-103877148 GAATTCTCCATCTCCATGAATGG + Intergenic
978688412 4:111477878-111477900 GAATTCCTCTTGGGAAAGAAAGG - Intergenic
980601968 4:135038053-135038075 GAAGTCTCCTTGGGGAAGGATGG - Intergenic
981834795 4:149042517-149042539 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
981933706 4:150216803-150216825 TGATTCTGCTTGGCCAAGGAGGG - Intronic
983273538 4:165591029-165591051 GGAATCCTCTTGGCCAAGAAGGG + Intergenic
983399037 4:167239702-167239724 GAATTCTACTTGGCTGAGTAAGG + Intergenic
983770421 4:171541842-171541864 GGAGTCTCCTTGGCCATGAGAGG - Intergenic
985054820 4:186027072-186027094 GAGGTCTCCTTGGCTCAGAAGGG - Intergenic
985302177 4:188502164-188502186 TAATCCTTCTTGGCTAAGAATGG - Intergenic
985627444 5:996842-996864 GGAGTCCCCTTGGCCAAGAAGGG - Intergenic
986777897 5:11035539-11035561 TAATTCCCCTTGGCCACGTAAGG + Intronic
986801091 5:11261109-11261131 TACTTCACCTTGGCCCAGAAAGG + Intronic
987152981 5:15060245-15060267 GAAGTCTCCTTGGGGAAGGATGG - Intergenic
988179238 5:27767684-27767706 TAATTATCCATGGTCAAGAATGG - Intergenic
989097632 5:37795912-37795934 GAAGTCTCCTTGGGGAAGGATGG - Intergenic
989542044 5:42628905-42628927 GGAGTCCCCTTGGCCAAGAAGGG + Intronic
991695111 5:69263745-69263767 GTTTTCTTCTTGGCCATGAATGG - Intronic
992120898 5:73591209-73591231 AAATTCTCAATGGACAAGAAGGG - Intergenic
993412768 5:87593234-87593256 GAGGTCTCCTTGGGGAAGAATGG + Intergenic
994984609 5:106917143-106917165 GAAGTCTCCTTGGGGAAGGATGG + Intergenic
995648868 5:114344762-114344784 AATTTAGCCTTGGCCAAGAAAGG - Intergenic
996165143 5:120213944-120213966 GAGTTCTCCTTGGGCAAGGATGG + Intergenic
996582375 5:125045939-125045961 GAATTCTCCAGGGACAACAAGGG + Intergenic
996908883 5:128633443-128633465 GAAGTCTCCTTGGGGAAGGATGG + Intronic
998168636 5:139859144-139859166 GAAGACTCCTTGGGCTAGAAGGG - Intronic
999030708 5:148288006-148288028 CTATTCTCCTTGGACAAAAAAGG - Intergenic
1000407709 5:160906371-160906393 AAGTTCTCCTGGGCCAAAAAGGG + Intergenic
1000658643 5:163912853-163912875 GAATTCTCCTTTCCCAGCAAAGG - Intergenic
1001243414 5:170087419-170087441 GCTTTCTCCTTTCCCAAGAAGGG + Intergenic
1002407282 5:179044985-179045007 GAGATCCCCTTGGCCAAGAGGGG + Intergenic
1002416464 5:179123294-179123316 GAATTTTCCTTGGGCAAGGCTGG - Intronic
1003210004 6:4054190-4054212 GAATTTATCTTGGCCAAGCATGG - Intronic
1003321327 6:5054618-5054640 GAATCCTTCTTGGCCAAGAGAGG - Intergenic
1003798063 6:9628566-9628588 GTGGTCCCCTTGGCCAAGAAGGG + Intronic
1004110729 6:12716099-12716121 CAATTCTGCTTGGTCAACAAAGG + Intergenic
1005055746 6:21727318-21727340 AAATGCTTCTTGTCCAAGAATGG - Intergenic
1008061578 6:47003092-47003114 GAAATCTCCTTGGCTGAGAGGGG - Intronic
1008104100 6:47424439-47424461 GGGTTCTTCTTGGCCAAGAGAGG - Intergenic
1008126234 6:47672425-47672447 GAGTTCTTCTTGGCTAAAAATGG + Intronic
1008427328 6:51374584-51374606 GAATACTTATTGGCCAATAAAGG + Intergenic
1009429802 6:63553472-63553494 AAGTTCTTCTTGGCCAAGACAGG + Intronic
1009787180 6:68354916-68354938 GAAGTCTCCTTGGGGAAGGATGG + Intergenic
1011039550 6:83014703-83014725 GATTTCTCCTTGGGGAAGGATGG + Intronic
1011769913 6:90664037-90664059 GAATTCTCCATGGCCACCTAGGG + Intergenic
1011824632 6:91291594-91291616 GAATTCTACTTGGCCCAGCTTGG - Intergenic
1012943534 6:105442219-105442241 TAATTCTCCTTTGCCATGTAAGG - Intergenic
1013092378 6:106911967-106911989 GCAGTCCCCTTGGCCAAGATGGG + Intergenic
1013832428 6:114290587-114290609 GAATTCTCCTAGGACAAGGCTGG - Intronic
1014795217 6:125716935-125716957 GAACTGTCCTGGGCCAAGAATGG - Intergenic
1015860869 6:137678578-137678600 GAATTCTCATTGTGGAAGAAGGG + Intergenic
1016576443 6:145574014-145574036 GAAGTCTCCTTGGGGAAGTACGG + Intronic
1016644466 6:146389576-146389598 AAATTCTCCTTGGTTAAAAATGG + Intronic
1021248670 7:18296528-18296550 TGTTTCTCCTTGGCCAAGAGGGG - Intronic
1023463902 7:40432395-40432417 AAATTCTCCTTGGCCAGGTGCGG + Intronic
1026290270 7:68999844-68999866 GCAGTCCCCTTGGCCAAGAAGGG - Intergenic
1026537808 7:71254665-71254687 GGAATGCCCTTGGCCAAGAAGGG + Intronic
1027993778 7:85397338-85397360 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1030277263 7:107734674-107734696 GAAGTCTCCTTGGGGAAGGATGG - Intergenic
1030641343 7:112010105-112010127 TAGTTCTCCTTGGCCAGGCATGG - Intronic
1030715006 7:112799439-112799461 GAAGTCCCCTTGGCCAAGAAGGG + Intergenic
1031342054 7:120614862-120614884 GTTTTCTCCTGGGCCAAGAATGG - Intronic
1032568157 7:132969851-132969873 GAGGTCCCCTTGGCCAAGAGGGG - Intronic
1032916380 7:136494791-136494813 GAATTCTCCTTCCCCAACAATGG - Intergenic
1033147592 7:138884351-138884373 GAAGTCCCTTTGGCCAAGAGGGG - Intronic
1034836245 7:154353930-154353952 GAATTCTCCTTGGACATTAAGGG - Intronic
1038231040 8:25700550-25700572 GGAGTCCCCTTGGCCAAGAGGGG - Intergenic
1040632545 8:49232478-49232500 GACTTATCATTGGCCAAGAAAGG - Intergenic
1041595924 8:59652313-59652335 GAAATATCATTGGCCAAAAAGGG - Intergenic
1043413791 8:80028527-80028549 TAATTCTCCTTTGCCACGGAAGG - Intronic
1043608119 8:82027558-82027580 GGAATGCCCTTGGCCAAGAAGGG - Intergenic
1043882786 8:85564239-85564261 GGCATCTCCTTGGCAAAGAAAGG + Intergenic
1044083063 8:87908695-87908717 GGAATCCCCTTGGCCAAAAAGGG - Intergenic
1045998829 8:108395553-108395575 TAATTATCCATGGCCAAGAGGGG - Intronic
1046455367 8:114452918-114452940 GAATTCTCCCTTGCAAATAATGG - Intergenic
1047553700 8:125905763-125905785 TCATCCTCCTTGGCCAAAAAAGG - Intergenic
1049429479 8:142553111-142553133 GGAATCCCCTTGGCCAAGAAGGG + Intergenic
1049695933 8:143984303-143984325 GGTTTCTCCTGGGCCCAGAAGGG - Exonic
1052340543 9:27360540-27360562 GAATTACCCTTGTCAAAGAAAGG + Intronic
1052541467 9:29816759-29816781 GGGTTCACCTTGGGCAAGAAAGG - Intergenic
1052998113 9:34562287-34562309 GAATTCTCCTTGGCGCACTATGG - Intronic
1056314437 9:85374373-85374395 GCAGTCTCCTTGGGGAAGAATGG + Intergenic
1056781089 9:89551644-89551666 GGGGTCCCCTTGGCCAAGAAAGG + Intergenic
1056802677 9:89703928-89703950 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1056947466 9:91011317-91011339 GAATCCTGCTTGACCAAGCAGGG - Intergenic
1057190699 9:93085753-93085775 CAGTTCTCCTTGGCCAAGACAGG + Intergenic
1058010804 9:99974733-99974755 AAATTCTGCTTGGAAAAGAAGGG + Intergenic
1059115566 9:111598138-111598160 GAATTTTCTTTGGCCCAGTAGGG + Intronic
1059590223 9:115650965-115650987 GCATTCTCCTTGCCAATGAATGG + Intergenic
1059765784 9:117382589-117382611 GAATGCTCCTAGGCCAGGGATGG + Intronic
1060149666 9:121280228-121280250 GAATTCTTAGTGGCGAAGAACGG + Intronic
1060340993 9:122777038-122777060 GGGATCCCCTTGGCCAAGAAGGG + Intergenic
1061270645 9:129539576-129539598 GAATTCTCCTGAGCCACAAAAGG + Intergenic
1061967239 9:134022367-134022389 GAGGTCCCCTTGGCCAAGAGGGG + Intergenic
1062371764 9:136242929-136242951 GGGGTCTCCTTGGCCAAGAGGGG - Intronic
1187101550 X:16198043-16198065 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1190069535 X:47268245-47268267 GAATTCTCCTAGACCAAGACAGG + Intergenic
1190077296 X:47326823-47326845 GAATTCTCCTAGACCAAGACAGG - Intergenic
1191719435 X:64217079-64217101 GAAGTCTCCTTGGGGAAGGATGG + Intergenic
1191742719 X:64452729-64452751 GAGGTCTCCTTGGAGAAGAATGG + Intergenic
1193537920 X:82736848-82736870 GAATGCTTTTTGGCCAAGAGTGG - Intergenic
1194034272 X:88852216-88852238 GGATTCTCTTTGGCCTAGAGGGG - Intergenic
1194513607 X:94823670-94823692 GAGGTCTCCTTGGGAAAGAAGGG + Intergenic
1194847420 X:98827527-98827549 CAATTTTCCTTCTCCAAGAAAGG + Intergenic
1195524672 X:105872925-105872947 GCATTCTCCGTGGCCTCGAAGGG + Intronic
1195751734 X:108166117-108166139 TTATTCTCTTTGGCCAAAAAGGG - Intronic
1197398482 X:125958220-125958242 GAAATCTCCTTGACAAAGACTGG + Intergenic
1199144632 X:144350390-144350412 AAAGTCTCCTTGGAGAAGAATGG + Intergenic
1200299765 X:154961689-154961711 GGGGTCTCCTTGGCCGAGAAAGG - Intronic