ID: 1098132836

View in Genome Browser
Species Human (GRCh38)
Location 12:67368360-67368382
Sequence CTGGAAACACAGAGAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098132831_1098132836 7 Left 1098132831 12:67368330-67368352 CCTTGTTATAAGGAAAATATTGG No data
Right 1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG No data
1098132830_1098132836 10 Left 1098132830 12:67368327-67368349 CCACCTTGTTATAAGGAAAATAT No data
Right 1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098132836 Original CRISPR CTGGAAACACAGAGAAAGGA TGG Intergenic
No off target data available for this crispr