ID: 1098134359

View in Genome Browser
Species Human (GRCh38)
Location 12:67385972-67385994
Sequence AATATCCAGTGAAGCTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098134358_1098134359 8 Left 1098134358 12:67385941-67385963 CCTTACAAATACAAACAGGGTCT No data
Right 1098134359 12:67385972-67385994 AATATCCAGTGAAGCTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098134359 Original CRISPR AATATCCAGTGAAGCTTAGC TGG Intergenic
No off target data available for this crispr