ID: 1098135549

View in Genome Browser
Species Human (GRCh38)
Location 12:67397994-67398016
Sequence TATTTTGAGCAGAGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098135543_1098135549 9 Left 1098135543 12:67397962-67397984 CCTTAGATTAAAAAATCAAGTTT No data
Right 1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098135549 Original CRISPR TATTTTGAGCAGAGGCTGGT GGG Intergenic
No off target data available for this crispr