ID: 1098139551

View in Genome Browser
Species Human (GRCh38)
Location 12:67437809-67437831
Sequence GCTGGCTCCTCCTTCTTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098139551_1098139555 -7 Left 1098139551 12:67437809-67437831 CCCGAGAAGAAGGAGGAGCCAGC No data
Right 1098139555 12:67437825-67437847 AGCCAGCCATAGACAGGTCTGGG No data
1098139551_1098139558 14 Left 1098139551 12:67437809-67437831 CCCGAGAAGAAGGAGGAGCCAGC No data
Right 1098139558 12:67437846-67437868 GGACAGAGCATTCCGTGTTAAGG No data
1098139551_1098139554 -8 Left 1098139551 12:67437809-67437831 CCCGAGAAGAAGGAGGAGCCAGC No data
Right 1098139554 12:67437824-67437846 GAGCCAGCCATAGACAGGTCTGG No data
1098139551_1098139559 15 Left 1098139551 12:67437809-67437831 CCCGAGAAGAAGGAGGAGCCAGC No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098139551 Original CRISPR GCTGGCTCCTCCTTCTTCTC GGG (reversed) Intergenic