ID: 1098139552

View in Genome Browser
Species Human (GRCh38)
Location 12:67437810-67437832
Sequence GGCTGGCTCCTCCTTCTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098139552_1098139559 14 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data
1098139552_1098139558 13 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139558 12:67437846-67437868 GGACAGAGCATTCCGTGTTAAGG No data
1098139552_1098139555 -8 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139555 12:67437825-67437847 AGCCAGCCATAGACAGGTCTGGG No data
1098139552_1098139554 -9 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139554 12:67437824-67437846 GAGCCAGCCATAGACAGGTCTGG No data
1098139552_1098139561 30 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139561 12:67437863-67437885 TTAAGGGAACATCAAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098139552 Original CRISPR GGCTGGCTCCTCCTTCTTCT CGG (reversed) Intergenic