ID: 1098139556

View in Genome Browser
Species Human (GRCh38)
Location 12:67437827-67437849
Sequence GTCCCAGACCTGTCTATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098139556_1098139562 14 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139562 12:67437864-67437886 TAAGGGAACATCAAGTGCAAGGG No data
1098139556_1098139558 -4 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139558 12:67437846-67437868 GGACAGAGCATTCCGTGTTAAGG No data
1098139556_1098139561 13 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139561 12:67437863-67437885 TTAAGGGAACATCAAGTGCAAGG No data
1098139556_1098139559 -3 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data
1098139556_1098139563 22 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139563 12:67437872-67437894 CATCAAGTGCAAGGGCGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098139556 Original CRISPR GTCCCAGACCTGTCTATGGC TGG (reversed) Intergenic