ID: 1098139559

View in Genome Browser
Species Human (GRCh38)
Location 12:67437847-67437869
Sequence GACAGAGCATTCCGTGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098139557_1098139559 -7 Left 1098139557 12:67437831-67437853 CCATAGACAGGTCTGGGACAGAG No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data
1098139551_1098139559 15 Left 1098139551 12:67437809-67437831 CCCGAGAAGAAGGAGGAGCCAGC No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data
1098139556_1098139559 -3 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data
1098139552_1098139559 14 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139559 12:67437847-67437869 GACAGAGCATTCCGTGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098139559 Original CRISPR GACAGAGCATTCCGTGTTAA GGG Intergenic
No off target data available for this crispr