ID: 1098139561

View in Genome Browser
Species Human (GRCh38)
Location 12:67437863-67437885
Sequence TTAAGGGAACATCAAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098139552_1098139561 30 Left 1098139552 12:67437810-67437832 CCGAGAAGAAGGAGGAGCCAGCC No data
Right 1098139561 12:67437863-67437885 TTAAGGGAACATCAAGTGCAAGG No data
1098139556_1098139561 13 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139561 12:67437863-67437885 TTAAGGGAACATCAAGTGCAAGG No data
1098139557_1098139561 9 Left 1098139557 12:67437831-67437853 CCATAGACAGGTCTGGGACAGAG No data
Right 1098139561 12:67437863-67437885 TTAAGGGAACATCAAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098139561 Original CRISPR TTAAGGGAACATCAAGTGCA AGG Intergenic
No off target data available for this crispr