ID: 1098139562

View in Genome Browser
Species Human (GRCh38)
Location 12:67437864-67437886
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098139556_1098139562 14 Left 1098139556 12:67437827-67437849 CCAGCCATAGACAGGTCTGGGAC No data
Right 1098139562 12:67437864-67437886 TAAGGGAACATCAAGTGCAAGGG No data
1098139557_1098139562 10 Left 1098139557 12:67437831-67437853 CCATAGACAGGTCTGGGACAGAG No data
Right 1098139562 12:67437864-67437886 TAAGGGAACATCAAGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098139562 Original CRISPR TAAGGGAACATCAAGTGCAA GGG Intergenic
No off target data available for this crispr