ID: 1098141418

View in Genome Browser
Species Human (GRCh38)
Location 12:67453673-67453695
Sequence CTGGCGCGGCAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098141409_1098141418 25 Left 1098141409 12:67453625-67453647 CCTCTGCCCCTAATCAAATCTTT No data
Right 1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG No data
1098141407_1098141418 27 Left 1098141407 12:67453623-67453645 CCCCTCTGCCCCTAATCAAATCT No data
Right 1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG No data
1098141412_1098141418 17 Left 1098141412 12:67453633-67453655 CCTAATCAAATCTTTTCTGCTTA No data
Right 1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG No data
1098141410_1098141418 19 Left 1098141410 12:67453631-67453653 CCCCTAATCAAATCTTTTCTGCT No data
Right 1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG No data
1098141411_1098141418 18 Left 1098141411 12:67453632-67453654 CCCTAATCAAATCTTTTCTGCTT No data
Right 1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG No data
1098141408_1098141418 26 Left 1098141408 12:67453624-67453646 CCCTCTGCCCCTAATCAAATCTT No data
Right 1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098141418 Original CRISPR CTGGCGCGGCAGAATGAGGA GGG Intergenic
No off target data available for this crispr