ID: 1098150627

View in Genome Browser
Species Human (GRCh38)
Location 12:67542819-67542841
Sequence GGATGGGCTTAGAGCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098150620_1098150627 19 Left 1098150620 12:67542777-67542799 CCTACAGGAGTCAGCCAGGTGAG No data
Right 1098150627 12:67542819-67542841 GGATGGGCTTAGAGCCTCATTGG No data
1098150622_1098150627 5 Left 1098150622 12:67542791-67542813 CCAGGTGAGTCAGAGGCGTAGAG No data
Right 1098150627 12:67542819-67542841 GGATGGGCTTAGAGCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098150627 Original CRISPR GGATGGGCTTAGAGCCTCAT TGG Intergenic
No off target data available for this crispr