ID: 1098152226

View in Genome Browser
Species Human (GRCh38)
Location 12:67558390-67558412
Sequence GACACTAGGTATTTGAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098152223_1098152226 6 Left 1098152223 12:67558361-67558383 CCAGCTTGGGTAGTTTGGGACTA No data
Right 1098152226 12:67558390-67558412 GACACTAGGTATTTGAGAAGTGG No data
1098152220_1098152226 18 Left 1098152220 12:67558349-67558371 CCTTCTTAAAGGCCAGCTTGGGT No data
Right 1098152226 12:67558390-67558412 GACACTAGGTATTTGAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098152226 Original CRISPR GACACTAGGTATTTGAGAAG TGG Intergenic
No off target data available for this crispr