ID: 1098155590

View in Genome Browser
Species Human (GRCh38)
Location 12:67594391-67594413
Sequence CAGTCAACACTGATGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098155584_1098155590 21 Left 1098155584 12:67594347-67594369 CCTAATTGTCACAGTATCTGATG No data
Right 1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG No data
1098155588_1098155590 -7 Left 1098155588 12:67594375-67594397 CCAAATGAGTAAGGGACAGTCAA No data
Right 1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG No data
1098155583_1098155590 22 Left 1098155583 12:67594346-67594368 CCCTAATTGTCACAGTATCTGAT No data
Right 1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098155590 Original CRISPR CAGTCAACACTGATGAAGGT TGG Intergenic
No off target data available for this crispr