ID: 1098158333

View in Genome Browser
Species Human (GRCh38)
Location 12:67623305-67623327
Sequence TAGGCGCCTTTGGATTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098158326_1098158333 8 Left 1098158326 12:67623274-67623296 CCTACAACCCAGAAAGAGACCCA No data
Right 1098158333 12:67623305-67623327 TAGGCGCCTTTGGATTTCAGAGG No data
1098158327_1098158333 1 Left 1098158327 12:67623281-67623303 CCCAGAAAGAGACCCAGTGTATT No data
Right 1098158333 12:67623305-67623327 TAGGCGCCTTTGGATTTCAGAGG No data
1098158325_1098158333 13 Left 1098158325 12:67623269-67623291 CCTCTCCTACAACCCAGAAAGAG No data
Right 1098158333 12:67623305-67623327 TAGGCGCCTTTGGATTTCAGAGG No data
1098158328_1098158333 0 Left 1098158328 12:67623282-67623304 CCAGAAAGAGACCCAGTGTATTG No data
Right 1098158333 12:67623305-67623327 TAGGCGCCTTTGGATTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098158333 Original CRISPR TAGGCGCCTTTGGATTTCAG AGG Intergenic
No off target data available for this crispr