ID: 1098161284

View in Genome Browser
Species Human (GRCh38)
Location 12:67649445-67649467
Sequence CGCCAAGCCCCGGGCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098161284_1098161292 19 Left 1098161284 12:67649445-67649467 CCTGCGCTGCCCGGGGCTTGGCG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 1098161292 12:67649487-67649509 AGCTGTCCAAACCCACCTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 177
1098161284_1098161294 26 Left 1098161284 12:67649445-67649467 CCTGCGCTGCCCGGGGCTTGGCG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 1098161294 12:67649494-67649516 CAAACCCACCTCCCGGCTGCTGG 0: 1
1: 1
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098161284 Original CRISPR CGCCAAGCCCCGGGCAGCGC AGG (reversed) Intronic
900122331 1:1054178-1054200 CGGCAGGCTCCGGGCAGGGCCGG - Intronic
900138850 1:1130686-1130708 CGACCAGCCCCGGGCAGGGCAGG - Intergenic
900361076 1:2289455-2289477 CCCCGAGCCCCGCGCAGGGCAGG + Intronic
900561582 1:3309752-3309774 CTCCTAGCCCAGGGCAGCCCTGG - Intronic
900600294 1:3499976-3499998 CGGCAAGGCCCGGGCACGGCTGG - Intronic
900795949 1:4708510-4708532 GGCCAAGCCCCAGGCTGAGCAGG + Intronic
901083647 1:6597673-6597695 TGCCAAGGCCAGGGCAGCTCTGG + Intronic
901316437 1:8312941-8312963 CGGCATGCCCAGGGCAGCCCAGG + Intergenic
901791285 1:11654812-11654834 CGCCCCGCCCCGCGCAGCGCTGG - Intronic
901798188 1:11692315-11692337 CCCTGAGCCCCGGGCAGAGCTGG + Intronic
902553250 1:17231603-17231625 GGCCAAGCCCGGGGCAGGTCAGG - Intronic
902657858 1:17881916-17881938 CGCCCAGACCCTGGCAGAGCAGG + Intergenic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
906627041 1:47333883-47333905 CGCCCCGCCCCGCGCCGCGCCGG + Exonic
907305044 1:53508616-53508638 AGCCAAGCCTGGGGCAGAGCTGG + Intronic
907909825 1:58815911-58815933 CGACACGCCCAGGGAAGCGCTGG - Intergenic
910237162 1:85048144-85048166 CGCCCAGCCCCGGGCAGGCCCGG + Intronic
910678976 1:89843486-89843508 CGCCACGGCCAGGGGAGCGCTGG + Intronic
911498785 1:98661563-98661585 CGCCCGGCCCGGGCCAGCGCTGG + Intergenic
912716893 1:111989587-111989609 CGCCGAGCGCCCAGCAGCGCGGG + Intergenic
912746433 1:112249185-112249207 TACCAAGCCCAGGGCAGGGCTGG + Intergenic
915335817 1:155140513-155140535 CGCCAACATCCGGGCCGCGCGGG - Intronic
915529127 1:156493414-156493436 CTCTAAGCCCCTGGCAGCGGAGG + Intronic
916606048 1:166343286-166343308 CTGCAAGCCCCGGGCAGTGAGGG - Intergenic
921167487 1:212517360-212517382 CCCCACGCCCCAGGCACCGCTGG - Intergenic
923293841 1:232573682-232573704 CCCCCAGCCCCGGGCAGAGCAGG + Intergenic
923623232 1:235594640-235594662 CCGCAAGCCCCGGGCAGTGAGGG - Intronic
1063139772 10:3245621-3245643 CAGCAAGCCCCGTGCAGCGTGGG + Intergenic
1063309307 10:4937636-4937658 CCGCAAGCCCCGGGCAGTGAGGG - Intronic
1063454625 10:6174486-6174508 CTCCAAGCCCAGGTCAGCCCGGG - Intronic
1064017479 10:11783796-11783818 CGCCCAGCCTCTGGCAGGGCGGG + Intergenic
1067113953 10:43420560-43420582 CGCCCCGCCGCCGGCAGCGCTGG - Intergenic
1070770929 10:79081980-79082002 CGACAAGTCCCTGGCAGAGCTGG + Intronic
1072619972 10:97073442-97073464 AGCCAAGCCCAGGGCAGCCAGGG + Intronic
1072990299 10:100186132-100186154 CTCCTAGCCGCGGGCCGCGCAGG + Exonic
1073094169 10:100969755-100969777 GGCCAGGCCTCGGGCTGCGCGGG + Intronic
1073320951 10:102615990-102616012 CGACAAGCCCAGGGCAGGGATGG + Intronic
1074678908 10:115883093-115883115 CGCAAAGCCCTGCCCAGCGCTGG - Intronic
1075645464 10:124093335-124093357 CGCCCAGCCCCGGCCGCCGCCGG + Intronic
1076630317 10:131848443-131848465 CGCCAGGCCCCAGGCAGCTCAGG - Intergenic
1076809375 10:132878743-132878765 CGCCCAGCCGTGGGCAGAGCAGG - Intronic
1077034058 11:486396-486418 CACCTGGCCCCGGGGAGCGCAGG + Intronic
1077074219 11:692983-693005 CGCCAGGCCCATGGCAGCCCTGG + Intronic
1077074944 11:696061-696083 CGCCTGGCCCCGGGCAGGGTGGG + Intronic
1080503694 11:32892925-32892947 CGCAAAGACCCGGGCCGCGGCGG - Intergenic
1081315199 11:41622982-41623004 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
1081644666 11:44781320-44781342 CCCCAGGCCCTGGGCAGCCCCGG - Intronic
1082811795 11:57482912-57482934 CCCCAAGCCCCGGGGAGTGGGGG + Intergenic
1083857519 11:65400478-65400500 GGCCAAGCCCCTGACAGCGGGGG - Intronic
1084095054 11:66905838-66905860 CGCCAGGGCCTGGGCAGCCCAGG - Intronic
1085020697 11:73205045-73205067 CCCCAAGCCCAGGCCAGGGCAGG - Intergenic
1089319436 11:117614933-117614955 AGACAAGCCCAGGGCAGGGCGGG + Intronic
1090668030 11:128927802-128927824 GGCCAAGCCCGAGGCTGCGCTGG + Intergenic
1092695887 12:11171180-11171202 CGCGTAGCCCCGGGCGCCGCTGG - Intronic
1095088977 12:38086679-38086701 CACCAAGCCCCAGGCAGGCCAGG - Intergenic
1098161284 12:67649445-67649467 CGCCAAGCCCCGGGCAGCGCAGG - Intronic
1100581405 12:95943296-95943318 CTCCCAGCCCCGGACAGCGCAGG + Exonic
1101144814 12:101830921-101830943 CGGCCAGACCCGGGCGGCGCCGG - Exonic
1102116040 12:110403635-110403657 TGCAAAGCCGCGGGCAGCGGCGG + Exonic
1102904016 12:116660832-116660854 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
1102933523 12:116879645-116879667 CGCCAGCGCCCGGGCTGCGCGGG + Intronic
1103587801 12:121969035-121969057 AGCCGAGCCACAGGCAGCGCAGG - Intronic
1104707547 12:130958641-130958663 CGCCTGCCCCCGGGCAGCTCTGG + Intronic
1104716690 12:131020390-131020412 CCCCAAGCTCCGGCCAGGGCAGG + Intronic
1106087722 13:26558033-26558055 CGAGAAGCCCCTGCCAGCGCGGG - Intronic
1106415079 13:29539664-29539686 CACCAAGCCCAGGGAAGTGCTGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1113489321 13:110678952-110678974 GGTCAAGCCTCGGGCAGGGCTGG + Intronic
1113681056 13:112245453-112245475 CCCCAAACCCTGGGCAGGGCTGG + Intergenic
1113877382 13:113602769-113602791 AGCCAGGCCCAGGGCAGGGCTGG - Intronic
1116900957 14:50362033-50362055 CCACAAGCCCCGGGCAGTGAGGG + Intronic
1118705768 14:68478982-68479004 ATCCAAGCCCCGGGCAGCAAGGG + Intronic
1119027777 14:71167645-71167667 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1119303678 14:73590688-73590710 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1121288808 14:92757825-92757847 CTCGAAGCCCCAGGCAGCTCTGG + Intergenic
1122718066 14:103707138-103707160 CGTCCAGCACCGGGCAGCCCAGG + Exonic
1123084750 14:105712262-105712284 AGCCCAGCCCAGGGCAGCTCAGG + Intergenic
1124051016 15:26197660-26197682 CACCAAGCACAGGGCAGCTCCGG - Intergenic
1124051027 15:26197711-26197733 CACCAAGCACAGGGCAGCTCCGG - Intergenic
1124198585 15:27656658-27656680 CCACAAGCCCCGGGCAGTGAGGG - Intergenic
1124962289 15:34408010-34408032 GGCCAGGCCCCTGGCAGCTCAGG - Intronic
1124978912 15:34554231-34554253 GGCCAGGCCCCTGGCAGCTCAGG - Intronic
1126104656 15:45139515-45139537 CACCAAGGCCAGGGCAGCACTGG + Exonic
1129196933 15:73973859-73973881 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1131115392 15:89792191-89792213 TGACAAGCTCCGGGCAGCCCTGG - Exonic
1131284223 15:91044007-91044029 CGGGAAGTCCTGGGCAGCGCAGG + Intergenic
1132576869 16:668336-668358 CGCCTCGCCCCGCGCAGCCCAGG + Exonic
1132640140 16:974481-974503 CCCCCAGCACCGGGCAGCCCTGG - Intronic
1132976438 16:2713467-2713489 CGCCAGGCCCAGGGCAGGGTGGG - Intronic
1133271546 16:4613087-4613109 TGCCCAGCCCCAGGCAGCGAGGG + Intronic
1136541565 16:30930286-30930308 CGGCCAGCCCGGGGCAGCTCTGG + Exonic
1137300418 16:47143616-47143638 CGCGAAGCGCCGGGCAGCTCGGG - Exonic
1138473569 16:57257504-57257526 GGCCAAGCCCAGGGGAGGGCAGG - Intronic
1139377332 16:66508394-66508416 GGCCAAGCCCAGGGCAGCCAGGG + Exonic
1141555282 16:84833171-84833193 CTCAAAGCTCTGGGCAGCGCGGG + Intronic
1141720138 16:85751283-85751305 CTCCAGGCCCCGGGCAGTCCCGG + Intergenic
1142740524 17:1929310-1929332 TGCAAGGCCCCGGCCAGCGCTGG - Intergenic
1143135271 17:4709303-4709325 CGGCCAGCCCCGGGCAGTGAGGG - Intergenic
1143202680 17:5123136-5123158 CGCCCAGCCACTGCCAGCGCCGG - Intronic
1144786251 17:17833493-17833515 CTCCCAGCCCCGGGCAGCTGTGG - Intronic
1146271308 17:31487792-31487814 CGCCCAGCTCAGGGCAGCCCTGG - Intronic
1146574292 17:33978136-33978158 CACCAAGCCCTGGCCAGCACAGG - Intronic
1147031737 17:37643468-37643490 TCCCAGGCCCCGGGCAGCGTCGG + Intergenic
1147742994 17:42679294-42679316 AGCCAAGCGCGGGGCAGGGCGGG + Exonic
1148023371 17:44568324-44568346 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1149849320 17:60026008-60026030 CGCCCAGCCACTGCCAGCGCCGG + Intergenic
1149860848 17:60120516-60120538 CGCCCAGCCACTGCCAGCGCCGG - Intergenic
1150775821 17:68080763-68080785 CCGCAAGCCCCGGGCAGCGAGGG + Intergenic
1151660675 17:75516511-75516533 CGCCACGCCCCGCCCACCGCCGG - Exonic
1151814928 17:76467100-76467122 TGCCAAGGCCTGGGCAGCCCTGG + Intronic
1152049281 17:77959389-77959411 CGCCAGGCCCCGGGCCGGCCGGG + Intergenic
1152658183 17:81529629-81529651 AGCCAAGCCCTGGGCAGCTGCGG + Intronic
1156969665 18:43139629-43139651 CCCCCAGCCCCGGGCAGTGAGGG + Intergenic
1160832644 19:1110903-1110925 AGCCAAGCCTCAGGCTGCGCTGG + Intronic
1161057237 19:2196792-2196814 CGCCAAGACCAGGGCAGGGAAGG - Intronic
1161965313 19:7544640-7544662 CCCCAAGCCTGGGGCAGAGCTGG - Intronic
1162039790 19:7963827-7963849 CGTCAGGCCACGGTCAGCGCAGG + Intronic
1163035352 19:14566317-14566339 CCCCAAGCCCTGGGAAGCGGAGG + Intronic
1163436858 19:17301207-17301229 CGCTTGGCCCCCGGCAGCGCAGG - Exonic
1164834730 19:31349774-31349796 CGCCGAGCCCCGGGCCGCGGCGG - Intergenic
1166366463 19:42280793-42280815 CGCCAAGGCCCGAGCAGAGGAGG - Intronic
927853351 2:26513442-26513464 AGACAGGCCCCGGGCAGCCCAGG - Intronic
928701548 2:33903770-33903792 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
929580452 2:43078911-43078933 TGCCAAGCCACAGGCAGCTCTGG + Intergenic
932496534 2:72148467-72148489 CGCGCCGCCCCGGGCAGCCCAGG - Intergenic
934105631 2:88692068-88692090 CGCCTAGCTCCTGGCAGGGCGGG + Intronic
934925515 2:98379537-98379559 CGGCAAGCTCCAGGCAGGGCCGG + Intronic
935397013 2:102619742-102619764 CGCCCTGCCCCGTGCAGGGCAGG - Exonic
936550775 2:113437762-113437784 CGTCAGGCCCCGGGCAGGCCGGG + Exonic
937312475 2:120910647-120910669 CGCCAAGCCACGGGCAGAAGAGG + Intronic
938392842 2:130918499-130918521 CGCCCAGAGCCGGGGAGCGCAGG + Intronic
941112146 2:161427270-161427292 CGGGTAGCGCCGGGCAGCGCCGG - Intronic
941784205 2:169479907-169479929 CGCTAAGCCCCGGGTGGCCCCGG - Intronic
942453543 2:176123017-176123039 CTCCCAGCCCCCGGCAGCGGCGG + Exonic
943117398 2:183691112-183691134 CCCCCAGCCCCAGGCAGCTCAGG - Intergenic
945401388 2:209387486-209387508 CGGCAAGCCCCGGGCAGTGAGGG + Intergenic
946354618 2:219177022-219177044 CGCCAAGCCCGGGGCGGAACAGG - Intronic
947399215 2:229714882-229714904 CCCCAAGGCCCGGGCAGGGCAGG + Intergenic
947669081 2:231925550-231925572 CACCAAGTCGCGGGCAGCGTGGG - Exonic
948660899 2:239505875-239505897 CACCAAGCACCCGGCAGTGCAGG - Intergenic
948814751 2:240504179-240504201 CGCCAGGACCCAGGCAGCCCAGG + Intronic
1169065583 20:2692849-2692871 GGCCAGGCCCCGGGGAGCGGCGG + Intergenic
1171982786 20:31639025-31639047 CACCAAGCTCCAGGCAGCTCTGG - Exonic
1172764951 20:37346282-37346304 CCCCCCGCCCCGGCCAGCGCGGG + Intronic
1173631794 20:44521831-44521853 AGCCAAGGCCCGTGCAGCTCTGG + Intronic
1175300661 20:57940582-57940604 CCCAAAGCCCAGGGCAGGGCTGG + Intergenic
1175477566 20:59287869-59287891 TGCGAAGCCCCAGGCAGGGCTGG - Intergenic
1178425603 21:32476752-32476774 AGCCAGGCCTCGGGCAGCCCTGG - Intronic
1179967406 21:44815449-44815471 CGCCAAGCCACTGGCATCCCGGG - Intronic
1180066966 21:45417411-45417433 CCCCAAGCCCCGGGGAACCCAGG - Intronic
1180871592 22:19149973-19149995 CGCCGCGCCCCGGGCTCCGCCGG + Intronic
1182338031 22:29598275-29598297 CGGCAAGCCCCGGGCAGTGAGGG - Intergenic
1182354327 22:29715569-29715591 CGCCAGGCCCCGGGCATAGGTGG + Intergenic
1183607198 22:38872596-38872618 CGCCAGGCCCCGGGCGGAGAAGG + Intergenic
1184462852 22:44649133-44649155 TGCTAAGCCCCAGGCAGCCCAGG + Intergenic
1184523783 22:45009808-45009830 GGCCATGCTCCGGGCCGCGCCGG - Intronic
1184775449 22:46620757-46620779 CCCCTGGCCCCGGGCTGCGCAGG - Intronic
1184880183 22:47299636-47299658 AGCCAAGCCTCGTGCAGCCCAGG - Intergenic
950864510 3:16178543-16178565 AGCCAAGGCCTGGGCTGCGCAGG - Intronic
953439611 3:42906418-42906440 CGGCGCGCCCGGGGCAGCGCGGG - Exonic
953748636 3:45593820-45593842 GGCCCCGCCCCTGGCAGCGCTGG - Intronic
959752129 3:109850213-109850235 TGCCAAGACCAGTGCAGCGCTGG - Intergenic
960868597 3:122227430-122227452 CCGCAAGCCCCGGGCAGTGAGGG - Intronic
960996347 3:123342925-123342947 TCCCCAGCCCCGCGCAGCGCAGG - Intronic
961013405 3:123449814-123449836 AGCCGAGGCCCGGGCGGCGCGGG - Intergenic
961383295 3:126509743-126509765 CGCCCAGCCCCTGGCCGCTCAGG + Intronic
961465049 3:127076494-127076516 CCACAAGCCCCGGGCAGTGAGGG - Intergenic
963974024 3:151460882-151460904 CGCCAAGCCCCAGCCGGCGTGGG + Intergenic
968701493 4:2060016-2060038 CGCCGGGCCCCGCGCAGGGCTGG + Intronic
970108311 4:12609739-12609761 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
971281688 4:25246866-25246888 CGCCAGGCCCCAGGCAGTGAGGG - Intronic
971327147 4:25654068-25654090 CCCCAAGCACAGGGCAGAGCAGG + Intergenic
974807571 4:66899711-66899733 CGGCCAGCCCCGGGCAGTGAGGG - Intergenic
985643460 5:1074326-1074348 CCCCAAGCCCAGGGCTGTGCTGG + Intronic
986464652 5:8008758-8008780 CCCCAAGCCCCAGGCAGCACGGG - Intergenic
995112379 5:108442291-108442313 CCGCAAGCCCCGGGCAGTGAAGG - Intergenic
995388354 5:111612417-111612439 CGGCCAGCCCCGGGCAGTGAGGG - Intergenic
997294005 5:132758633-132758655 CGCCAGGCCCGGGGCAGCCTGGG + Intronic
997352210 5:133239094-133239116 CGGCAAGCCCCGGGCAGTGAGGG + Intronic
998692153 5:144598840-144598862 TGCCAGGCTCCGGGCTGCGCAGG + Intergenic
999731689 5:154480084-154480106 CGCCAGGCGCCGGGGAGAGCGGG - Intergenic
1002006401 5:176238329-176238351 CGCCAAGCCCCGCCCACCGGCGG - Intergenic
1002164157 5:177334246-177334268 CGCCCAGGCCCAGGCAGGGCGGG + Intronic
1002219979 5:177672308-177672330 CGCCAAGCCCCGCCCACCGGCGG + Intergenic
1002485286 5:179530783-179530805 CGCAGAGCCCCGGGAGGCGCGGG - Intergenic
1002529882 5:179837948-179837970 AGCCAAGGCCCAGGCAGGGCAGG - Exonic
1003173495 6:3738026-3738048 GGCCAGGCCCCGGGCTGGGCAGG - Intronic
1003178478 6:3771745-3771767 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1003868734 6:10385149-10385171 CGCCACGTCCCGGGCAGTTCAGG + Intergenic
1004196592 6:13511286-13511308 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1004714983 6:18208241-18208263 CTCCAAGCCCCTGGCAGCAAAGG - Intronic
1004905427 6:20233324-20233346 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1004914441 6:20319027-20319049 CTGCAAGCCCCGGGCAGTGAGGG + Intergenic
1005303756 6:24494980-24495002 CGCCATGGCCCGGGCAACGACGG - Exonic
1005648857 6:27867621-27867643 CACCAATCACAGGGCAGCGCCGG - Intergenic
1005997380 6:30939693-30939715 CCCTAAGCCCTGGGCAGGGCTGG - Intergenic
1006351111 6:33521759-33521781 CGGCTGGCCCCGGGCAGCGAGGG - Intergenic
1016104738 6:140148373-140148395 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1018060899 6:160088940-160088962 CCCCACTCCCCGGGCTGCGCAGG - Intronic
1019118502 6:169784750-169784772 TCCCAAGCACCGGGCAGTGCTGG - Intergenic
1019298534 7:291270-291292 CGCCTGGCCCCGGACAGCGCTGG + Intergenic
1019584090 7:1787271-1787293 AGCCAAGCCCGTGGCAGGGCTGG + Intergenic
1019621401 7:1994220-1994242 CGCCACACCCAGGGCAGCACAGG + Intronic
1019911455 7:4102756-4102778 CGCCAAACCCCGGCCAGACCTGG + Intronic
1023797652 7:43807178-43807200 CTGCAAGCCCCAGGCAGTGCAGG - Exonic
1023810216 7:43906251-43906273 CGCCGCGCCCCGGGCACCTCCGG + Intronic
1024323148 7:48089195-48089217 CGGTAACCCCCGGGCAGGGCGGG + Exonic
1026639346 7:72110458-72110480 AACCAAGCCCAGGACAGCGCAGG + Intronic
1026935725 7:74254289-74254311 AGCAAGGCCCCCGGCAGCGCCGG - Exonic
1027268334 7:76505872-76505894 CACCAGGCCCCGAGCACCGCGGG - Exonic
1027778954 7:82499721-82499743 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1029040507 7:97568154-97568176 CCCCCAGCCCCCGGCAACGCAGG + Intergenic
1034499547 7:151440656-151440678 CCCCCAGCTCAGGGCAGCGCGGG - Intronic
1035171409 7:157019351-157019373 CCCCCCACCCCGGGCAGCGCGGG + Intergenic
1035626129 8:1071998-1072020 CTTCAAGGCCCAGGCAGCGCTGG - Intergenic
1035833907 8:2727943-2727965 CCGCAAGCCCCGGGCAGTGAAGG + Intergenic
1037815340 8:22109035-22109057 CGCCACGCACGCGGCAGCGCTGG + Intronic
1038266501 8:26042919-26042941 CGACCAGCCCCGGGGATCGCTGG + Intronic
1039884312 8:41646606-41646628 CCCCGGGCCCCGGGCGGCGCGGG - Exonic
1041636687 8:60153210-60153232 CGGCAAGCCCCGGGCAGTGAGGG - Intergenic
1042521080 8:69711412-69711434 GGCCAAGACCTGGGGAGCGCAGG + Intronic
1045063463 8:98426964-98426986 CGCCGCGCCCCGCGCAGGGCGGG + Intronic
1045098931 8:98825862-98825884 CGCCCCGCCCCCGGCCGCGCCGG + Intronic
1045582936 8:103499824-103499846 TGCCCAGGCCCGGGCACCGCGGG - Intergenic
1047358064 8:124141856-124141878 CGCGAAGCGCCGGGCAGCTAGGG + Intergenic
1049270466 8:141693037-141693059 CACCACGCCCCGGGCAGTGATGG + Intergenic
1049339534 8:142104663-142104685 GGGGAAGCCCCGGGCAGCACAGG + Intergenic
1049604816 8:143524384-143524406 AGCCAAGCCACTGGAAGCGCAGG + Intronic
1049645582 8:143734238-143734260 CGTCGAGCCCCGGGCGGGGCCGG + Intergenic
1049902158 9:179054-179076 CGTCAGGCCCCGGGCAGGCCGGG - Exonic
1050249947 9:3733919-3733941 CGGCAATCCCCGGGCAGTGAGGG + Intergenic
1051079542 9:13279180-13279202 CGCGAAGCGCCGGGCCGCGCGGG + Intronic
1051449409 9:17178637-17178659 CGGCAGGCCCCGGGCAGTGAGGG - Intronic
1053003309 9:34589656-34589678 CGCCGAGCCTCGCGCCGCGCCGG + Exonic
1053475241 9:38377684-38377706 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1055689114 9:78810673-78810695 CGCAAAGCCCCTTGCAGAGCAGG - Intergenic
1056732355 9:89177652-89177674 CGCCCAACCCTGGGCAGCGGGGG - Intronic
1057733731 9:97633732-97633754 CGCCACGGCCCCGGAAGCGCAGG - Exonic
1057869713 9:98708705-98708727 CGCGGAGCTCCGGGCAGCCCGGG - Exonic
1060587631 9:124796247-124796269 GGCCAAGCCCCTGGCAGCAGGGG + Intronic
1060811582 9:126613784-126613806 CGCGGAGCCCCGGGGCGCGCGGG + Intergenic
1060952639 9:127613238-127613260 AGCCAAGCCCCGGGAAGGGGAGG - Intronic
1061489971 9:130939330-130939352 CCCCAAGACCCAGGCTGCGCCGG + Intergenic
1061517564 9:131098398-131098420 AGCCAAGCCCCAGGCTGGGCAGG - Intronic
1062346936 9:136119233-136119255 CTCCCAGCCCCAGGCCGCGCAGG - Intergenic
1190881460 X:54495401-54495423 CACCGAGCCCCGGGGGGCGCCGG - Exonic
1192251392 X:69416875-69416897 CCGCAAGCCCCGGGCAGTGAGGG + Intergenic
1194025595 X:88746580-88746602 CTGCAAGCCCCGGGCAGTGAGGG - Intergenic
1194890490 X:99372289-99372311 CCGCAAGCCCCGGGCAGTGAGGG - Intergenic
1196645751 X:118116428-118116450 CGCCGCGCACCGCGCAGCGCCGG + Intronic
1197533783 X:127663223-127663245 CCACAAGCCCCGGGCAGTGAGGG - Intergenic
1201469104 Y:14314598-14314620 CCACAAGCCCCGGGCAGTGAGGG + Intergenic
1202584393 Y:26408655-26408677 CGCCAAGGCCAGTGCAGCCCCGG + Intergenic