ID: 1098162601

View in Genome Browser
Species Human (GRCh38)
Location 12:67659742-67659764
Sequence ACTGTAAGGTTCTCTCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098162597_1098162601 25 Left 1098162597 12:67659694-67659716 CCAAAGAAGATTTAGCAGATTAG 0: 1
1: 0
2: 1
3: 9
4: 153
Right 1098162601 12:67659742-67659764 ACTGTAAGGTTCTCTCAGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098162601 Original CRISPR ACTGTAAGGTTCTCTCAGCC TGG Exonic