ID: 1098162760

View in Genome Browser
Species Human (GRCh38)
Location 12:67661988-67662010
Sequence CCACCCATTAAGTTTAAAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098162760_1098162766 27 Left 1098162760 12:67661988-67662010 CCACTTTTAAACTTAATGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1098162766 12:67662038-67662060 AGAATGTTAGAAAACACTTTAGG 0: 1
1: 0
2: 4
3: 55
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098162760 Original CRISPR CCACCCATTAAGTTTAAAAG TGG (reversed) Exonic