ID: 1098162760

View in Genome Browser
Species Human (GRCh38)
Location 12:67661988-67662010
Sequence CCACCCATTAAGTTTAAAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098162760_1098162766 27 Left 1098162760 12:67661988-67662010 CCACTTTTAAACTTAATGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1098162766 12:67662038-67662060 AGAATGTTAGAAAACACTTTAGG 0: 1
1: 0
2: 4
3: 55
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098162760 Original CRISPR CCACCCATTAAGTTTAAAAG TGG (reversed) Exonic
901762024 1:11478060-11478082 CCAGCCCTTATTTTTAAAAGAGG - Intergenic
905003289 1:34690256-34690278 CCACACCTGGAGTTTAAAAGTGG + Intergenic
908860021 1:68473997-68474019 CCACCCTTTTATTTTGAAAGTGG - Intergenic
911948522 1:104141100-104141122 CCACTCATTAAGTCTAAAGCTGG - Intergenic
913428930 1:118767327-118767349 GCACCCAATACGTTTAAAGGAGG - Intergenic
914243495 1:145868712-145868734 GCACACATTATGATTAAAAGTGG + Intronic
916099922 1:161385932-161385954 ACAGCCATTAAATTTCAAAGTGG - Intergenic
917186130 1:172358087-172358109 CCTCCCAATAGGATTAAAAGCGG - Intronic
917783422 1:178425318-178425340 TCACCCATTAAGTTAAAAACTGG - Intronic
1063081781 10:2774265-2774287 CAACCCACTAAGATTAATAGGGG + Intergenic
1063663148 10:8047498-8047520 CCAACCGTTAAGTAAAAAAGAGG - Intergenic
1064446158 10:15395142-15395164 CCTCCGATTACGTTTAAAATTGG - Intergenic
1072078195 10:92000250-92000272 CAACCCATTTGGTTTAAAGGTGG - Intronic
1081698468 11:45136307-45136329 GCACACATTAATTTTAAAATAGG - Intronic
1091609595 12:1994433-1994455 CCTCCCATCAATTTTAAAATTGG - Intronic
1096785586 12:54015499-54015521 CCACCCATAAATTTTATAACAGG - Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1100070480 12:90710065-90710087 ACACACATTCAGGTTAAAAGAGG - Intergenic
1101351330 12:103931905-103931927 ACACCGAGTAAGTTTAAAAATGG + Intronic
1109192040 13:59336951-59336973 CCAACCATTGAGTTTCAAACTGG - Intergenic
1109588970 13:64450673-64450695 AAACCCATTAACTTTATAAGAGG + Intergenic
1110816193 13:79862450-79862472 CCAACCATTGTATTTAAAAGGGG + Intergenic
1112166573 13:96926616-96926638 CTAACCATTAAGTTTAAGTGTGG + Intergenic
1113881335 13:113628490-113628512 CCACCCCTTAGATTTAACAGCGG - Intronic
1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG + Intergenic
1118776522 14:68977693-68977715 CCCCCTTTTAAGTTTAAAAAAGG + Intronic
1123153711 14:106205363-106205385 CCACCAGTTCAGTTTAGAAGGGG + Intergenic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1125515777 15:40320190-40320212 CCACACATTAAGTTGAACAAGGG - Intergenic
1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG + Exonic
1144040025 17:11402464-11402486 CCTCTCATTAAGTGGAAAAGAGG - Intronic
1148883617 17:50754334-50754356 TCACTCATGAAGTATAAAAGTGG - Exonic
1155531977 18:26776601-26776623 CCAACCAGTAAGTTCAAAAGAGG + Intergenic
1163284023 19:16335111-16335133 CCACGAATAAAGTTTAAAAAAGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
929657786 2:43751397-43751419 CCCCCCAGTAAGTTTACAAGAGG + Intronic
932746861 2:74341002-74341024 CCACCGAATAAATGTAAAAGAGG + Intronic
932860147 2:75283003-75283025 CAACTCATTATTTTTAAAAGCGG + Intergenic
933012360 2:77083462-77083484 CCAACCATTGATTTTAACAGTGG + Intronic
939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG + Intronic
939653787 2:144797012-144797034 ACACCCATTAATATGAAAAGAGG - Intergenic
940507561 2:154576411-154576433 CCACCAGTTTAGTTTAGAAGAGG + Intergenic
941892498 2:170596587-170596609 CCACCCATGAGGTTTATAGGGGG + Intronic
943462408 2:188184923-188184945 ACACCAATTAAGTTAAAAACAGG - Intergenic
943780441 2:191817528-191817550 CCACTCATTAAATGAAAAAGTGG - Intergenic
946108541 2:217393495-217393517 CCCCCCACTCAGTTTAAATGGGG + Intronic
948047284 2:234953615-234953637 CCACCCATTAATTTTTATGGTGG - Intronic
1170617314 20:17964410-17964432 CCAACACTTAAGTTTAAAAATGG - Intronic
1178518133 21:33265900-33265922 CCACTAATCAAGTTAAAAAGAGG + Intronic
1184244629 22:43229702-43229724 CCACCCATAAAGGTCAAAAAGGG + Intronic
952160948 3:30692402-30692424 CAACCCATGAAGGTAAAAAGTGG - Exonic
953720932 3:45354605-45354627 ACACACATTATGTTTAAGAGAGG - Intergenic
954535121 3:51354227-51354249 CCACCAAATAATTTTAAATGGGG - Intronic
957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG + Intronic
957459051 3:80493905-80493927 CCACAAATTATTTTTAAAAGAGG + Intergenic
957666500 3:83236892-83236914 CCATGCATTAGGTTGAAAAGAGG + Intergenic
959195047 3:103169389-103169411 CCACTCACAAAGTTTAAAATTGG + Intergenic
963310811 3:143708232-143708254 CAGCCCATTCAGTTTGAAAGGGG + Intronic
964476766 3:157104627-157104649 ACATGCATTAAGTTTAAACGTGG + Intergenic
970762675 4:19510193-19510215 GCGCCTATTAATTTTAAAAGGGG + Intergenic
975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG + Intronic
982034434 4:151331771-151331793 CCACCCATTTACATTAAAAGTGG - Intergenic
985781616 5:1874613-1874635 CAACCAATTAAGATTTAAAGTGG - Intergenic
991678738 5:69116468-69116490 TCACCCATGAAGTTATAAAGAGG - Exonic
991944770 5:71889440-71889462 CCAGCCAATATTTTTAAAAGGGG - Intergenic
992891553 5:81208857-81208879 CCATCAATTCTGTTTAAAAGTGG - Intronic
993630045 5:90275665-90275687 CCACCCATTATGTTAAATGGTGG - Intergenic
997718564 5:136060146-136060168 CCACCTACTTAGCTTAAAAGAGG + Intronic
1010168323 6:72943135-72943157 CCACACATTTAATTTAAAAAAGG - Intronic
1015068645 6:129061677-129061699 CCTCCCATTTAGTTTAATGGAGG + Intronic
1018496506 6:164352317-164352339 CCTACCATTAATTTAAAAAGAGG - Intergenic
1018773874 6:166996838-166996860 GCACCCATTAGGTTCAAGAGAGG - Intergenic
1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG + Intergenic
1023516313 7:41005372-41005394 CCACCCATGAGGGATAAAAGAGG + Intergenic
1024752564 7:52484979-52485001 CCACACAAACAGTTTAAAAGTGG + Intergenic
1027968836 7:85050037-85050059 CCACCCATTGACTTAAAAGGTGG + Intronic
1030700387 7:112631849-112631871 TTACCCATTACATTTAAAAGAGG - Intergenic
1036511311 8:9402917-9402939 CCTTCCCTTAATTTTAAAAGAGG - Intergenic
1041380895 8:57253641-57253663 CCACCTATTAAGGTTATAATAGG - Intergenic
1045576637 8:103428976-103428998 CTTTCCATTAAGTTTAAAACAGG - Intronic
1050288872 9:4132685-4132707 CCAACCATTCATTATAAAAGAGG + Intronic
1050735871 9:8762614-8762636 CAGGCCATTAATTTTAAAAGAGG - Intronic
1051341750 9:16118663-16118685 CCACCCATAAATTCAAAAAGGGG - Intergenic
1052120451 9:24709240-24709262 CCAACCATTATTTTTAAAATTGG + Intergenic
1056515466 9:87345248-87345270 ACATCCATTAACTTGAAAAGAGG + Intergenic
1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG + Intronic
1186318894 X:8402260-8402282 GCAGCCATTAAGTCTAAAGGGGG - Intergenic
1188819645 X:34758934-34758956 CAACCAATTAACTTTAGAAGAGG + Intergenic
1188819655 X:34759147-34759169 CAACCAATTAATTTTAGAAGAGG + Intergenic
1193124543 X:77857294-77857316 CCTCCCAGTAAGATTCAAAGGGG + Intronic
1197846411 X:130808569-130808591 CCACCAATTAGGTTAAAAGGAGG + Intronic
1200846001 Y:7832793-7832815 CCACCAGTTCAGTTTACAAGAGG - Intergenic
1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG + Intronic
1201875059 Y:18751449-18751471 TGACCCATAAACTTTAAAAGAGG - Intronic
1202168777 Y:22019133-22019155 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG + Intergenic
1202320531 Y:23628425-23628447 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG + Intergenic