ID: 1098162766

View in Genome Browser
Species Human (GRCh38)
Location 12:67662038-67662060
Sequence AGAATGTTAGAAAACACTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 604}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098162760_1098162766 27 Left 1098162760 12:67661988-67662010 CCACTTTTAAACTTAATGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1098162766 12:67662038-67662060 AGAATGTTAGAAAACACTTTAGG 0: 1
1: 0
2: 4
3: 55
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098162766 Original CRISPR AGAATGTTAGAAAACACTTT AGG Exonic
900260023 1:1722560-1722582 TGAATATTAGAATACATTTTGGG + Intronic
902725249 1:18331281-18331303 AGAATGATACAATAAACTTTGGG - Intronic
904463983 1:30697215-30697237 AGCTTGTTAGAAAAAACTCTAGG + Intergenic
904570608 1:31461571-31461593 AGGAAGTTAGAACACCCTTTGGG - Intergenic
904742618 1:32689973-32689995 AGAACTTTAGCAAACAGTTTAGG + Intronic
905430755 1:37921429-37921451 AGAAAGTAACAAAACAATTTGGG - Intronic
905509385 1:38506622-38506644 AGTATATAGGAAAACACTTTGGG + Intergenic
905745559 1:40414346-40414368 AGAATGTGAGAGAACAGTCTTGG - Intronic
906081412 1:43091302-43091324 AAAATGTTTGAAATCATTTTAGG + Intergenic
906829412 1:49015722-49015744 ATAATGTTAAAAATCACTTGAGG - Intronic
907207823 1:52790105-52790127 AGAATGTTAGAAATCTGTCTTGG + Intronic
908344587 1:63218966-63218988 AGAAAGGTAGAAAACTCTCTGGG + Intergenic
908377725 1:63561674-63561696 ATTATGTAAGAAAAAACTTTTGG + Intronic
908482491 1:64555824-64555846 AGAATATTTGAAAACACATATGG - Intronic
909160008 1:72135074-72135096 AGTATGTAAGAAATAACTTTCGG + Intronic
909505272 1:76381141-76381163 ATATTGTTAGAAAATAGTTTGGG + Intronic
910582533 1:88844206-88844228 ATGATTTTAAAAAACACTTTAGG - Intergenic
911714221 1:101112083-101112105 AGTATGTTAGAACCCACCTTTGG + Intergenic
911732173 1:101302420-101302442 AAAATGATAGCGAACACTTTGGG + Intergenic
911976618 1:104505508-104505530 AGGATATTAAAGAACACTTTAGG - Intergenic
912219880 1:107661310-107661332 AGGATGGTAGCAAGCACTTTGGG - Intronic
912253202 1:108032107-108032129 AGAAAGATAGGAATCACTTTTGG - Intergenic
912452446 1:109775576-109775598 GGAATTTTAGAAAACTCTGTTGG - Intergenic
912619869 1:111144519-111144541 AGAAGGTTAAAAAACAATCTAGG + Intronic
913143272 1:115962964-115962986 AGAAGCTTGGAAAACATTTTGGG + Intergenic
913299927 1:117359975-117359997 AGAATGTTGGCAAGCCCTTTTGG - Intergenic
914983817 1:152439824-152439846 AGATTTCTAGAAAACACTTCAGG - Intergenic
915719437 1:157973559-157973581 AGAATGTGAGGAAACACATGAGG - Intergenic
915799733 1:158777379-158777401 AGAATATTAGACAACATCTTAGG + Exonic
916347891 1:163814751-163814773 AGAATGATACAATAGACTTTGGG - Intergenic
916565889 1:165976757-165976779 AGAATGATAAAATAGACTTTGGG - Intergenic
916675505 1:167061859-167061881 AAAAAGTTAGTAGACACTTTGGG - Intronic
917287268 1:173434345-173434367 AGAAGTTTAGAAAATGCTTTAGG - Intergenic
917728797 1:177853946-177853968 AGAATGTTAAAATGGACTTTAGG + Intergenic
917828087 1:178845232-178845254 AGAATGTGAGTATACTCTTTTGG + Intronic
918442337 1:184580028-184580050 AGAAAGTTAGCCAATACTTTTGG - Intronic
918573985 1:186033263-186033285 AGAATGATATAATGCACTTTGGG + Intronic
919122759 1:193361706-193361728 AGAATGATACAATAGACTTTGGG + Intergenic
919342082 1:196324068-196324090 AGAATATTCGACAATACTTTCGG + Intronic
919920943 1:202166100-202166122 AGAATGGAAGAAAAGGCTTTGGG - Intergenic
920193214 1:204208673-204208695 AGAATGATACAATAGACTTTGGG + Intronic
921112271 1:212050259-212050281 AGTATGGTAGAAAACATCTTTGG + Intronic
921197105 1:212768689-212768711 AGAATGATATAATAGACTTTAGG + Intronic
921644178 1:217593711-217593733 AAAATTTTAGAGAACATTTTTGG - Intronic
923207880 1:231776242-231776264 AGAATGTTAGAAAGCATCCTAGG - Intronic
923945150 1:238877428-238877450 AGAATGATACAATAGACTTTGGG - Intergenic
924406744 1:243755628-243755650 AGATTATAAGAAAACACTTTGGG - Intronic
1063200653 10:3783292-3783314 AAAATGGTAGGAAACATTTTAGG + Intronic
1063822431 10:9853282-9853304 AGAATGATTTATAACACTTTAGG + Intergenic
1064511015 10:16091525-16091547 AGAATGATATAACAGACTTTGGG + Intergenic
1064695416 10:17960162-17960184 ATAATGTTAAAAAAAATTTTTGG - Intronic
1064890689 10:20169300-20169322 TGAATATTAGAAAGCTCTTTGGG - Intronic
1065062994 10:21927310-21927332 AGAATGGTAGCTAACATTTTAGG + Intronic
1065178458 10:23101182-23101204 AGAATGATACAATAGACTTTGGG - Intronic
1066144952 10:32547965-32547987 AGAATGATACAATAGACTTTGGG - Intronic
1066710664 10:38230332-38230354 AGAATGATACAATACACTTTGGG - Intergenic
1066787475 10:39021263-39021285 AGAATCTGAGAAAAGACATTTGG - Intergenic
1066793802 10:39096270-39096292 AGAATCTGAGAAAAGACTTTTGG + Intergenic
1067330791 10:45316717-45316739 ACAATGTTAAAAAAAACTTGTGG + Intergenic
1068011526 10:51457394-51457416 AGAATGATATAATAGACTTTGGG + Intronic
1068172875 10:53419284-53419306 AGAATGACAGAATAGACTTTGGG + Intergenic
1068461396 10:57334310-57334332 AGAATGTTAGCAAAGATTTGAGG + Intergenic
1068566673 10:58583388-58583410 AGAATGTTATAATGGACTTTGGG - Intronic
1068649399 10:59504685-59504707 AGAATGTTAAAAAGCTATTTGGG + Intergenic
1069001219 10:63268315-63268337 ATACTGTTAGAAAACAAGTTGGG + Intronic
1069243290 10:66169200-66169222 AGAATGATACAATAGACTTTGGG - Intronic
1070044270 10:72815562-72815584 ACAATGTTAGAAAACAATAGAGG + Intronic
1070463514 10:76693512-76693534 AGAATCACAGAAAACACTTTTGG - Intergenic
1071766908 10:88677007-88677029 AGAAGGTTACAAAATACTATAGG - Intronic
1073603974 10:104874824-104874846 TCAATATTAGAAAACACCTTTGG + Intronic
1073855286 10:107666417-107666439 AGTATGTTAGAGAAAACCTTTGG + Intergenic
1073859706 10:107723990-107724012 AGAAAGAAAGAAAACAATTTTGG + Intergenic
1074445294 10:113516571-113516593 AGAATGATATAATAGACTTTGGG + Intergenic
1074748832 10:116563564-116563586 AGAATGATACAAAGGACTTTGGG - Intronic
1075037909 10:119084629-119084651 AAGATGATAGAAACCACTTTGGG + Intergenic
1075841772 10:125510779-125510801 AGCATTTTAGAAAACAAGTTGGG + Intergenic
1076284512 10:129280031-129280053 AGAAAGCTAAAAAACAATTTTGG + Intergenic
1077046188 11:546603-546625 AGAAAGTTGGAAAACACTTTGGG + Intronic
1077665981 11:4109949-4109971 AGAATGTTATGAAATACTTATGG - Intronic
1078121107 11:8509682-8509704 AGAATGATATAAAGGACTTTGGG - Intronic
1078738174 11:14041101-14041123 AAAATGTTAAAACACCCTTTTGG - Intronic
1078982469 11:16552121-16552143 AGAATGTTGGAAAAAATTTTAGG - Intronic
1079275373 11:19030657-19030679 AGAATGATACAATAGACTTTGGG - Intergenic
1079429468 11:20375180-20375202 AGAATGTTAGAAGGTACCTTAGG - Intronic
1079862613 11:25692860-25692882 AGAATGATACAATAGACTTTGGG - Intergenic
1080672041 11:34389181-34389203 AGAATGATACAATAGACTTTGGG - Intergenic
1080733429 11:34984756-34984778 AAAATGTTAGCATATACTTTTGG + Intronic
1080835458 11:35936512-35936534 AGAATGATAGAAAGGACTCTGGG + Intergenic
1081461521 11:43276635-43276657 AGAATGATATAATAGACTTTGGG - Intergenic
1082125571 11:48427715-48427737 AGAATGATACAATAGACTTTGGG - Intergenic
1082254454 11:50018113-50018135 AGAATGTCATCAAACACTTCTGG - Intergenic
1082291436 11:50377908-50377930 AGAATGCTAGAAAGGACATTTGG + Intergenic
1082559191 11:54598745-54598767 AGAATCATACAAAAGACTTTGGG - Intergenic
1082615284 11:55352837-55352859 AGATTTTTAGTTAACACTTTTGG + Intergenic
1082927095 11:58560903-58560925 TGAAAGTTAGAAAACAATCTAGG - Intronic
1083385838 11:62309453-62309475 AGAAAGTTAGAAAAAAGTATAGG - Intergenic
1084011030 11:66348445-66348467 AGAAGGAAAGAAAACACCTTTGG - Intronic
1085653523 11:78290933-78290955 AGGATGTTAGCAAATATTTTGGG + Intronic
1086146036 11:83552795-83552817 ACAATGTTAGAAAAAATTCTTGG - Intronic
1086153237 11:83636757-83636779 AGCATGGCAGAAAACATTTTGGG - Intronic
1086938917 11:92774932-92774954 ACAATGTTAGATAACAATATGGG + Intronic
1087092778 11:94291762-94291784 AGAATGATATAAAGCACTTTGGG + Intergenic
1087282188 11:96223935-96223957 AGATTGTCAAAAAATACTTTGGG - Intronic
1087403753 11:97702542-97702564 GTAAAGTTAGAAAAGACTTTTGG - Intergenic
1087608313 11:100404547-100404569 AGAAAGTTAGGAAACAATGTGGG + Intergenic
1087631885 11:100660007-100660029 AGAATGATACAATGCACTTTGGG + Intergenic
1088077314 11:105866681-105866703 AGGATTTTAGGAAATACTTTTGG - Intronic
1088206916 11:107403072-107403094 AGAATGATACAATGCACTTTGGG + Intronic
1088815555 11:113418433-113418455 AGAATCTAAGAAAACACATGGGG - Intronic
1089982965 11:122787726-122787748 ACAATCTAAGAAAACACCTTAGG - Intronic
1090701302 11:129298258-129298280 AAAATATTTGAAAATACTTTTGG - Intergenic
1090965482 11:131594348-131594370 AGAATGTTACATAAGATTTTGGG - Intronic
1091089511 11:132757284-132757306 AGAATGATACATAATACTTTGGG + Intronic
1091927580 12:4368195-4368217 AGAAAGAAAGAAAACACTTTAGG + Intergenic
1092649544 12:10618658-10618680 GCAATTTTAAAAAACACTTTGGG - Intergenic
1093118299 12:15237712-15237734 TGAATATTATAAAACAATTTCGG + Intronic
1093390328 12:18611260-18611282 AAAATGTGAAAAAACACTTAGGG + Intronic
1093468452 12:19475249-19475271 AGAATGATATAATAGACTTTGGG - Intronic
1093472042 12:19512320-19512342 GTATTGTTAAAAAACACTTTTGG - Intronic
1093853806 12:24073633-24073655 AGAATCTGTGAAAACACTTCAGG + Intergenic
1093919150 12:24839896-24839918 AGAATGTTAGGAAAAACCTTTGG - Intronic
1094284608 12:28779153-28779175 AAAATGGTAGAACAGACTTTTGG - Intergenic
1095079806 12:37985940-37985962 AGAAAGTTAGAACAGACATTTGG + Intergenic
1095100409 12:38176048-38176070 AGTATGGCAGAAAACACTCTGGG - Intergenic
1095294707 12:40514740-40514762 AAGATGTTAGTAAACACTTTAGG - Intronic
1095674526 12:44900729-44900751 AAAAAGCTAGCAAACACTTTGGG + Intronic
1096328388 12:50686917-50686939 AGAAAGTTACAAAAGACTTTAGG + Intronic
1097603643 12:61725886-61725908 AGAATGATACAATAAACTTTGGG + Intronic
1097691844 12:62741094-62741116 AGAATGCTAGAAGACAGATTTGG - Intronic
1098162766 12:67662038-67662060 AGAATGTTAGAAAACACTTTAGG + Exonic
1098239452 12:68451887-68451909 AGAATGTTTTAAAACACTGATGG - Intergenic
1098524579 12:71471968-71471990 AGAATGATAAAATAAACTTTGGG + Intronic
1099152058 12:79126557-79126579 AGCATATTATTAAACACTTTTGG - Intronic
1099613136 12:84901387-84901409 GGAATATTATAGAACACTTTAGG - Intronic
1099699651 12:86067215-86067237 AGAATGATTTATAACACTTTGGG - Intronic
1099891127 12:88589585-88589607 AGAATGATATAATAAACTTTGGG + Intergenic
1100007587 12:89912608-89912630 AGAATGATATAATAAACTTTGGG - Intergenic
1100322118 12:93505537-93505559 AGAATGTTTGAAAATTATTTTGG - Exonic
1100483229 12:95000293-95000315 AGAATGATATAAAGGACTTTGGG + Intronic
1100520178 12:95367280-95367302 AGAATGATACAATAGACTTTGGG + Intergenic
1100553142 12:95666242-95666264 AGAATGATATAATATACTTTGGG + Intronic
1101130152 12:101681325-101681347 AGAATGAGAGAAAACACATTAGG - Intronic
1102941967 12:116950929-116950951 AGAGTGTCAGAAGACACTTGAGG + Intronic
1103880456 12:124162168-124162190 AGGATGTTATAATACACATTTGG + Intronic
1105597752 13:21855355-21855377 AGAATGTTACAATGGACTTTGGG - Intergenic
1106144340 13:27038210-27038232 AGCATATTCAAAAACACTTTTGG - Intergenic
1106988544 13:35386634-35386656 TGAATTTTAAAAAATACTTTGGG - Intronic
1107085647 13:36425275-36425297 TGAAAATTAGAAAACACTTATGG + Intergenic
1107593831 13:41939981-41940003 AGTGTGTTAGAAAATTCTTTTGG - Intronic
1108424701 13:50287911-50287933 AGAATGTTACAATAAACTTTGGG - Intronic
1108664123 13:52612303-52612325 ATAATGTTAGAAAAGAATCTGGG + Intergenic
1108992457 13:56678030-56678052 AGAATGTCAGTACATACTTTTGG + Intergenic
1109952902 13:69524384-69524406 ATAATATTAGGAAATACTTTTGG - Intergenic
1111076754 13:83247499-83247521 AGAATATTAAAAAACACTTTGGG + Intergenic
1111361167 13:87179464-87179486 AGAAAATTACAAAACTCTTTTGG - Intergenic
1111584275 13:90263341-90263363 AATATGTTAAAAAACACTTCTGG - Intergenic
1111637417 13:90923982-90924004 AAAATGATAGAAAATGCTTTAGG + Intergenic
1111875574 13:93890076-93890098 AGCATATGTGAAAACACTTTGGG - Intronic
1112654980 13:101442277-101442299 AGAATGATACAATAAACTTTGGG + Intergenic
1113526845 13:110985883-110985905 AGCATTTTACAAAACACTGTAGG - Intergenic
1114340420 14:21737056-21737078 AAAATTTTAGAAAGCACTTTTGG - Intergenic
1114546385 14:23505337-23505359 AGAATGATACAAAAGACTTTGGG - Intronic
1114789645 14:25642558-25642580 GGAATGTTATAAAAGTCTTTTGG - Intergenic
1115102183 14:29715642-29715664 AGAATGTTTGAAAAAACCTTTGG - Intronic
1115888887 14:38004903-38004925 AATAAGTTAGAACACACTTTGGG + Intronic
1115894767 14:38074070-38074092 ATAATGTGAGAAAAGGCTTTGGG + Intergenic
1116215506 14:42011978-42012000 AGAATGATACAATAGACTTTGGG + Intergenic
1116268052 14:42721216-42721238 AGAAAGTTAGGAAAAGCTTTAGG - Intergenic
1116297068 14:43125533-43125555 AGAATGGTAGAAAACTGTCTAGG + Intergenic
1116545153 14:46156139-46156161 AGAATGATACAACAAACTTTGGG - Intergenic
1116591547 14:46782092-46782114 AGAAACTTGGAAAACACATTTGG + Intergenic
1116621037 14:47203422-47203444 AGAATGTTTGAATACACTGAGGG + Intronic
1120401269 14:84035463-84035485 AGATTATTAGAAAAAAATTTTGG - Intergenic
1120580509 14:86242024-86242046 AGAATGATAAAACAGACTTTGGG - Intergenic
1120643136 14:87039778-87039800 AGAATGATATAATGCACTTTGGG + Intergenic
1120684790 14:87525790-87525812 ACAGTGTTAGTGAACACTTTTGG + Intergenic
1121083860 14:91130131-91130153 TGATTGTTATAAACCACTTTAGG - Intronic
1123184105 14:106498111-106498133 AGAATGATACAATAGACTTTGGG - Intergenic
1124275160 15:28320819-28320841 AGAATGTGAGGAAACAATGTTGG - Intronic
1124474868 15:30024480-30024502 ACAATATCTGAAAACACTTTTGG - Intergenic
1125013120 15:34902009-34902031 AGAATGTTACAAAATACAGTGGG + Intronic
1125186170 15:36933062-36933084 ACAATTTTAGAACAGACTTTAGG + Intronic
1125624817 15:41099479-41099501 AGAATGCTAAAAAATACTTTTGG + Intronic
1126232907 15:46348210-46348232 AGAATTTGAAAAAACATTTTGGG + Intergenic
1126642943 15:50846183-50846205 AGAATGATAGAATGGACTTTGGG + Intergenic
1126992730 15:54401157-54401179 AGAATGAGATAAAATACTTTAGG - Intronic
1127130758 15:55860066-55860088 AGAATGTTAGAAAAGACTTCAGG - Intronic
1127266162 15:57364074-57364096 AAAATGGTAGAAAACATTTTAGG - Intergenic
1127442205 15:59021083-59021105 AGAATGATACAAAGGACTTTGGG - Intronic
1127677395 15:61254505-61254527 GAAAAGTTAGAGAACACTTTGGG - Intergenic
1128186030 15:65644224-65644246 AGAATGTAAGACAGAACTTTGGG + Intronic
1130297024 15:82654604-82654626 AGAATGTAAGGAAACACCTATGG - Intergenic
1130317177 15:82806513-82806535 ACAAGGTTAAAAAACATTTTGGG + Intergenic
1130356621 15:83137962-83137984 AGATTATTTGAAAACACTGTAGG - Exonic
1131384580 15:91993320-91993342 AGAAAGTTACAGAGCACTTTTGG + Intronic
1131474219 15:92722508-92722530 AGAATGATATAATAAACTTTGGG - Intronic
1131749023 15:95485839-95485861 AGATGCTTATAAAACACTTTAGG + Intergenic
1131813360 15:96197343-96197365 AAGATGTGAGAAAGCACTTTTGG - Intergenic
1132664857 16:1076816-1076838 AAAATGTTAGGAAATACATTTGG - Intergenic
1133365770 16:5208250-5208272 GGAATGTAAGAAATCACTTCAGG - Intergenic
1133441183 16:5822251-5822273 AGAATGATACAATAGACTTTGGG + Intergenic
1133532827 16:6671637-6671659 AGAATGATAGAACGGACTTTGGG - Intronic
1134682450 16:16135826-16135848 AGAATCTTCTAAGACACTTTAGG - Intronic
1135342039 16:21657110-21657132 TGAAAGTTAGAAAACACTTTGGG - Exonic
1137953822 16:52809029-52809051 AGAATGATATAATAAACTTTGGG + Intergenic
1139028892 16:62854942-62854964 AGAATGTTAGAAAAGAAATCGGG - Intergenic
1139704805 16:68733930-68733952 AGGATTTTAGAAAACAATTAGGG - Intergenic
1140532811 16:75681731-75681753 AGAATGATATAATAAACTTTGGG - Intronic
1141916949 16:87104746-87104768 AGAATGGGAGAAAATATTTTTGG - Intronic
1143149859 17:4801184-4801206 AGAAGGTTAGAAAGGACTTGGGG + Intergenic
1145063398 17:19746127-19746149 ATAATCCTAGCAAACACTTTGGG + Intronic
1146417720 17:32652241-32652263 AGGATGTAAGAAGACATTTTTGG - Intronic
1146754515 17:35416319-35416341 AGAATGATACAAAGGACTTTGGG + Intronic
1149211419 17:54306471-54306493 AGAAAGTTAGAAAGTACTTCAGG - Intergenic
1149899313 17:60459289-60459311 AAAATATTAAAAAGCACTTTGGG - Intronic
1150424871 17:65069231-65069253 AAAATTTTAAAAAACACTATTGG - Intergenic
1150511529 17:65757391-65757413 AGGATGGTAGAAAACATCTTTGG + Intronic
1150516533 17:65816462-65816484 AGAATGATACAAAAGACTTTGGG - Intronic
1151065007 17:71138517-71138539 AGAATGATACAATAGACTTTGGG - Intergenic
1152831692 17:82501225-82501247 ATAATTTTAGAAAAATCTTTTGG - Intergenic
1153195633 18:2592914-2592936 AGAAGGTTGGAAAACACTATTGG + Intronic
1153406297 18:4744126-4744148 AGAATGATATAATAGACTTTGGG + Intergenic
1153532242 18:6058889-6058911 AGAATCTTAGAAGCCAGTTTTGG + Intronic
1154203382 18:12316407-12316429 AAAATGTTAGAAATGACCTTTGG + Intronic
1155898544 18:31359828-31359850 AGAAAGTCACAAAAGACTTTAGG - Intergenic
1155924435 18:31639953-31639975 AGTAATTTTGAAAACACTTTAGG - Intronic
1156798709 18:41081082-41081104 AAAATGTTATACAAGACTTTGGG - Intergenic
1156877623 18:42034538-42034560 AAAATATAAGAAAACACTTAAGG - Intronic
1156956241 18:42967689-42967711 GAAATTTTAGAAAAAACTTTTGG - Intronic
1157126312 18:44959762-44959784 TGAATGATACAAGACACTTTGGG + Intronic
1157537203 18:48468583-48468605 AGATTGTTTGATAACACTGTGGG - Intergenic
1158013710 18:52759628-52759650 TGAATTTTAGAAAACCTTTTTGG + Intronic
1158117888 18:54016856-54016878 AGGGTGTTAGAAAAGATTTTAGG + Intergenic
1158172101 18:54611807-54611829 AGAATGATATAATGCACTTTGGG + Intergenic
1158442809 18:57492359-57492381 AGAATGATACAATAGACTTTGGG + Intergenic
1162679050 19:12324861-12324883 AAAATGGTAGAAAACCCTTATGG + Intronic
1163192053 19:15684428-15684450 AGAATGTCAGCAAATATTTTTGG + Intronic
1163229492 19:15990666-15990688 AGAATGTGAGCAAATATTTTTGG - Intergenic
1164252244 19:23489038-23489060 AGAATGATACAATAGACTTTGGG + Intergenic
1164339230 19:24371044-24371066 AGAAGTTTGGAAAACAGTTTTGG + Intergenic
1166217502 19:41345106-41345128 AGAAGGCAAGAAAACACCTTCGG - Intronic
1167188332 19:47964245-47964267 CTTATGTTAGAAAACACTTAGGG - Intergenic
925038617 2:712247-712269 AGGAAATTAGAAAATACTTTGGG - Intergenic
925102404 2:1259038-1259060 ATAATTTTAGAAAACCATTTTGG - Intronic
925234796 2:2268555-2268577 AAAATGTTTGAAAACTTTTTTGG + Intronic
925935168 2:8750705-8750727 ATAATGTTAGCAAAGACTGTGGG + Intronic
926642755 2:15254717-15254739 AGAATGACATAATACACTTTGGG - Intronic
926818382 2:16824474-16824496 ACAAAGTCAGAAAACAGTTTTGG - Intergenic
928044675 2:27917314-27917336 ATAATTTAAAAAAACACTTTGGG - Intronic
928578186 2:32677751-32677773 ATCATTTTAGAAAACAATTTGGG - Intronic
928734806 2:34275818-34275840 AGATTGCTAGAAAACGCATTTGG + Intergenic
928776302 2:34768071-34768093 ACAAGGTTAAAGAACACTTTGGG - Intergenic
929243259 2:39674482-39674504 AGAATGATACAATAGACTTTGGG + Intronic
929263060 2:39887885-39887907 AGAGGGTTAGAAAAACCTTTAGG - Intergenic
929378053 2:41314776-41314798 AAAATTTCAGAAAACACTTTAGG + Intergenic
930988668 2:57623370-57623392 GGAAAGTTATAAAATACTTTGGG + Intergenic
931103407 2:59028406-59028428 ATTATGTTTGAAATCACTTTTGG + Intergenic
932534105 2:72573486-72573508 AGAATGCTAGAAAACATTCAGGG + Intronic
932926162 2:75977607-75977629 AGAATGATACAATAGACTTTTGG + Intergenic
933085388 2:78048443-78048465 AGAATGATATAACAGACTTTGGG - Intergenic
933236599 2:79871121-79871143 AGAATTTTTTAAAACATTTTGGG + Intronic
933362848 2:81309764-81309786 AGGAAGTAAGAAGACACTTTAGG - Intergenic
933472861 2:82749289-82749311 AGAATATTATAAACAACTTTAGG - Intergenic
933604216 2:84364472-84364494 AGAATGTTATAATGAACTTTGGG + Intergenic
933896874 2:86819244-86819266 ATAATCTTAGAAAGCTCTTTTGG - Intronic
935436734 2:103043822-103043844 AGAATGATAGAATAGATTTTGGG + Intergenic
936690690 2:114884736-114884758 AGAATGATACAATAGACTTTGGG - Intronic
937714692 2:125018095-125018117 ACAGTGTTGGAAAACATTTTGGG - Intergenic
937762007 2:125616035-125616057 AGAATGATACAATAGACTTTGGG + Intergenic
937762170 2:125617979-125618001 AGAAGGTGATAAAATACTTTTGG - Intergenic
939914951 2:148028436-148028458 TCAATCTTAAAAAACACTTTGGG - Intronic
939934755 2:148277473-148277495 AGAATATTAAAAACAACTTTAGG - Intronic
940042316 2:149373385-149373407 AGAATGCATGAAATCACTTTGGG + Intronic
940131276 2:150386087-150386109 AGAAATTTAAAAAACAATTTAGG - Intergenic
940157293 2:150671339-150671361 AGAATGATACAATAGACTTTGGG + Intergenic
940162185 2:150725243-150725265 ATAAAATTAGAAAACAATTTAGG - Intergenic
940272682 2:151908850-151908872 GGAATTTGAGAAAACACTTAGGG - Intronic
940708922 2:157138503-157138525 AGAATGTTATAATAGACTTTGGG - Intergenic
941865942 2:170334745-170334767 AGAATGGCAGAAAGAACTTTAGG - Intronic
942558040 2:177191706-177191728 ACAATGTATGTAAACACTTTTGG + Intergenic
943127110 2:183807543-183807565 AGAATGTGAGAAAATTATTTGGG + Intergenic
943256264 2:185597163-185597185 AAACTGTTAGAAAACACTCTAGG + Intergenic
943393521 2:187301600-187301622 AAAATATTAGAAAAAAATTTGGG - Intergenic
943509544 2:188807504-188807526 AATATGTTAAAAAACACTGTAGG + Intergenic
943764079 2:191641694-191641716 AGAGTTTTAGAAAATTCTTTTGG - Intergenic
943930936 2:193852056-193852078 AGAAAGCTTGAATACACTTTTGG - Intergenic
943973149 2:194437173-194437195 AGAATGATACAATAGACTTTGGG - Intergenic
944878576 2:203987831-203987853 AGAATGATACAATAGACTTTGGG + Intergenic
946439029 2:219679511-219679533 AGGATGTTTGCAAACACCTTGGG + Intergenic
946933793 2:224698461-224698483 AGAATGATAAAATAGACTTTAGG - Intergenic
947173886 2:227340698-227340720 AGAAAGCTAAAAAATACTTTTGG - Intronic
947237325 2:227954992-227955014 AGAAAGTTAGAAAAAAATTAAGG + Intergenic
947257706 2:228183363-228183385 AGAATGCTACAATAGACTTTGGG - Intergenic
948325967 2:237121231-237121253 AGGATGTGACAAAACATTTTGGG + Intergenic
948361653 2:237425603-237425625 AGAATGATGAAAAACACGTTTGG - Intergenic
948730150 2:239957953-239957975 AGAGTATTAGAAAACACTAGCGG + Exonic
1169558523 20:6773902-6773924 AGGATTTTAAAACACACTTTGGG - Intronic
1169648179 20:7837261-7837283 AGAATGTTTGAATCCACTTCAGG + Intergenic
1169721940 20:8687508-8687530 AGAATGATATAATAGACTTTGGG - Intronic
1169792705 20:9428533-9428555 AGAATGGTAGAAAATACAGTAGG - Intronic
1169860935 20:10151439-10151461 AGAATGATACAATAGACTTTGGG - Intergenic
1170126832 20:12972790-12972812 AGAATGATACAACAGACTTTGGG - Intergenic
1170801921 20:19597422-19597444 ATAATTTTAGAAAACACGTATGG + Intronic
1171326833 20:24302114-24302136 TGCATGTTAGAAATCAGTTTTGG + Intergenic
1172863131 20:38072688-38072710 AGAATTTTAAAAAGCACTCTAGG + Intronic
1173019573 20:39255795-39255817 AGAATGGAAGAGAAGACTTTGGG - Intergenic
1173370887 20:42433915-42433937 AGAATGTTAGATATAATTTTGGG - Intronic
1173660300 20:44728626-44728648 AGGAAATTAGAAAACACTCTTGG + Intergenic
1173983840 20:47245635-47245657 CAAATGTTAACAAACACTTTGGG + Intronic
1174958803 20:55131987-55132009 AGACTGATAGCATACACTTTGGG + Intergenic
1175000172 20:55619314-55619336 AGAATGATAGAATGGACTTTGGG + Intergenic
1175357274 20:58378360-58378382 AGGATGTTACAGAACAGTTTTGG - Intergenic
1175886251 20:62292634-62292656 AGTTTGTTAGAAAAATCTTTGGG + Intronic
1176588710 21:8618640-8618662 AGAATGATATAATAGACTTTGGG + Intergenic
1176890767 21:14315856-14315878 AGAATATTAAACAAGACTTTTGG - Intergenic
1177661637 21:24091430-24091452 AGAAGGATACAATACACTTTGGG + Intergenic
1178101862 21:29278597-29278619 AAAACTTTAGAAAACAGTTTGGG + Intronic
1178115889 21:29416126-29416148 AGAATGATAAAAAAGACTTGGGG + Intronic
1178288564 21:31346734-31346756 AGAATGTTACAAATCACTCGTGG + Intronic
1178344548 21:31813694-31813716 AAAATGTCACAAAAAACTTTGGG + Intergenic
1178363080 21:31966082-31966104 AGAATGATACAATAGACTTTGGG - Intronic
1178564911 21:33674832-33674854 AAAATGTCAGAAGATACTTTGGG - Intronic
1178971623 21:37183393-37183415 AGAATCTTAAAACACACTCTTGG - Intronic
1179145354 21:38763284-38763306 AAAAAGTTATAAAACAATTTGGG - Intergenic
1179240627 21:39587640-39587662 AGAAGGTGAGAAAAAACTTACGG + Intronic
1180271538 22:10595636-10595658 AGAATGATATAATAGACTTTGGG + Intergenic
1181567692 22:23749733-23749755 AGAATTTTTGAAAATACTTTAGG - Intronic
1181858498 22:25800152-25800174 AGAATGATATAATAGACTTTGGG + Intronic
1183132068 22:35847275-35847297 AGAAAGTTCGAAAATATTTTAGG - Intronic
1183670233 22:39268592-39268614 CAAATGTTAGAAAACAGTTTGGG - Intergenic
1184994460 22:48195261-48195283 AGAATGATAGAAATCATGTTGGG - Intergenic
949138612 3:603129-603151 AGAATGATATAACAGACTTTGGG - Intergenic
950232636 3:11290011-11290033 AGGATGTGAGAAAACACATGGGG - Intronic
951153273 3:19318447-19318469 AGAATGATACAATAGACTTTGGG - Intronic
951319065 3:21223130-21223152 ATAATGTTAGTAGACACATTTGG - Intergenic
951690563 3:25391069-25391091 AGAATGATACAATAAACTTTGGG - Intronic
951979906 3:28553944-28553966 AGAATGATACAATAGACTTTGGG - Intergenic
952476105 3:33712322-33712344 AGAATGATAAAATAAACTTTGGG + Intronic
952580335 3:34825176-34825198 AGAATGATACAATGCACTTTGGG + Intergenic
952586238 3:34896010-34896032 AGAATGCCAGAAAACATATTAGG - Intergenic
952776694 3:37053247-37053269 AAAATGTTAGAAAAAAATATGGG - Exonic
952785644 3:37152259-37152281 AGAATGATATAATAGACTTTGGG + Intronic
953103443 3:39852560-39852582 AGAATGATATAAAGGACTTTGGG - Intronic
954307825 3:49739651-49739673 AGAATATTATAAAGAACTTTAGG - Intronic
954601075 3:51870104-51870126 GGAAAGTAAGAAAACAATTTCGG + Intergenic
955214254 3:56971866-56971888 AAAATTTTAAAAAGCACTTTGGG + Intronic
955541453 3:59980802-59980824 AGAATGTGAGAAAAAAATGTTGG + Intronic
955983488 3:64549844-64549866 AGATAATTAGAAAAGACTTTGGG + Intronic
956516612 3:70055976-70055998 AGAGAGTGAGACAACACTTTTGG - Intergenic
957074313 3:75589541-75589563 CGAATGTAAGAAATCACTTCTGG + Intergenic
957185891 3:76940508-76940530 ACAATTTTAAAAAGCACTTTTGG - Intronic
957373654 3:79328821-79328843 AGAATGATACAATAGACTTTGGG - Intronic
957469530 3:80640414-80640436 AGAATATTGAAAAACATTTTTGG + Intergenic
957607633 3:82423169-82423191 AGAATTTTTGAAAACATTTTTGG - Intergenic
958028786 3:88081961-88081983 AAAATGTTTTAAAACACATTAGG - Intronic
958087840 3:88835244-88835266 AGAATGATACAATAGACTTTGGG - Intergenic
959026880 3:101249524-101249546 GCAATGTTAGCAAACATTTTTGG + Intronic
959128198 3:102316975-102316997 AGATAATTAGAAAACACTTGGGG + Intronic
959224778 3:103565759-103565781 AGAATGTTAAAAAAGTATTTTGG + Intergenic
959253568 3:103980112-103980134 AGAAGGATAGAAAACACATAGGG + Intergenic
959340045 3:105117708-105117730 ATAATGATAAACAACACTTTAGG - Intergenic
959679235 3:109073706-109073728 AGTAATTTAGAAAACAATTTTGG - Intronic
959795118 3:110417731-110417753 AAAATCCTAGAAAACAATTTAGG + Intergenic
960337600 3:116437229-116437251 AGAATGATACAATAGACTTTGGG + Intronic
960440141 3:117676746-117676768 AGAATGTTAGAAACCATGGTAGG - Intergenic
960887851 3:122415162-122415184 AAAATGTTTGAAAACACTGAAGG - Exonic
960888062 3:122416913-122416935 AAAATGTTTGAAAACACTAAAGG - Intergenic
960895604 3:122501429-122501451 AGGAAATCAGAAAACACTTTGGG - Intronic
962296841 3:134197879-134197901 AGAATTTTTGAAAAGACTGTAGG + Intronic
962857380 3:139360220-139360242 AGAAGGTTAAAGAATACTTTCGG + Intronic
962906060 3:139804200-139804222 AGAATTCTACCAAACACTTTAGG - Intergenic
963012601 3:140786932-140786954 AGAATGATACAATACACTTTGGG + Intergenic
963193312 3:142498146-142498168 AAAATGTTGGAAAACATTTTAGG - Intronic
963410402 3:144920588-144920610 AAGATATTAGAAAACATTTTTGG - Intergenic
963433019 3:145233703-145233725 GAGATGTTTGAAAACACTTTGGG + Intergenic
963653182 3:148010669-148010691 AGAATGATATACAACAATTTAGG + Intergenic
963842037 3:150117610-150117632 TGAATTTTAGAAAACCATTTAGG - Intergenic
964325441 3:155541203-155541225 AGAATGATATAATAGACTTTGGG + Intronic
967439757 3:189492891-189492913 AGAATGATACAATAGACTTTGGG + Intergenic
967801281 3:193663519-193663541 TGAATTTTAAAAAATACTTTCGG + Intronic
968248814 3:197185527-197185549 AGAATGTAAGAAAATACTAAGGG + Intronic
969835391 4:9836118-9836140 AGAATGATACAACAGACTTTGGG + Intronic
970277427 4:14416803-14416825 AAAATGTAACAAACCACTTTTGG + Intergenic
970774634 4:19658576-19658598 AGAATCATAGAAAACAAATTAGG - Intergenic
970818242 4:20183302-20183324 AGAATGTTATAAAGGACTCTGGG - Intergenic
970913479 4:21306357-21306379 AGAATGTCACAAAACAGTGTGGG - Intronic
971367541 4:25989587-25989609 AGAAAATTAGAAACCACTCTAGG + Intergenic
971380332 4:26091317-26091339 AGAATGATATAAAGAACTTTGGG - Intergenic
971768741 4:30868990-30869012 AGAATGCTTGATAACATTTTTGG - Intronic
971900589 4:32652929-32652951 AGAATGATCAAAAAGACTTTGGG - Intergenic
972013890 4:34219883-34219905 AGAATGATACAATAGACTTTGGG + Intergenic
972168543 4:36316635-36316657 AGAGTATTAGAAAACATGTTAGG + Intronic
972231601 4:37078853-37078875 AGAATGATACAATAGACTTTGGG - Intergenic
972807010 4:42539224-42539246 AGAATGATACAACATACTTTGGG + Intronic
974645836 4:64690942-64690964 AGATTGTTAGAAAATTATTTGGG + Intergenic
974932776 4:68378316-68378338 ATTCTGTTTGAAAACACTTTGGG + Intergenic
975090155 4:70392105-70392127 AGAATCCTAGAAAAAAGTTTAGG + Intergenic
975226569 4:71879513-71879535 AGAATTCTATACAACACTTTAGG - Intergenic
975950296 4:79762362-79762384 AGAATGATACAACATACTTTGGG + Intergenic
975955739 4:79835921-79835943 AGAATGATACAATGCACTTTGGG - Intergenic
975976336 4:80101044-80101066 AGGATGTCAGAGAAAACTTTTGG - Intronic
976048543 4:80982959-80982981 AGAATGATACAATGCACTTTGGG + Intergenic
976147843 4:82060161-82060183 AGAAGTTATGAAAACACTTTTGG - Intergenic
977457396 4:97278718-97278740 AGAATATTAAAAGACACCTTGGG - Intronic
977525815 4:98143737-98143759 AGAACCTTAGAAAACGCGTTAGG + Intergenic
978037239 4:104010241-104010263 AGAATGATACAATAGACTTTGGG + Intergenic
978418065 4:108499967-108499989 AGAATCATATAAAATACTTTGGG - Intergenic
978549310 4:109907951-109907973 AGAATGATACAAAGGACTTTGGG + Intergenic
978655947 4:111065529-111065551 ATATAGTTAGAAAACATTTTTGG + Intergenic
979029562 4:115624723-115624745 TGAATGTTAAAAAAGACTTGAGG + Intergenic
979491773 4:121336494-121336516 AAAATGTAAGAAAACATTTAGGG + Intronic
980036638 4:127891553-127891575 AGAATTTTAAAAAAATCTTTTGG + Intronic
981646165 4:147001163-147001185 GCAATGTTATAAAACAGTTTTGG - Intergenic
981909120 4:149957598-149957620 AGCATGGTAGTAAGCACTTTGGG + Intergenic
982969649 4:161968252-161968274 AGAATGTTAGAAAACAAAATTGG + Intronic
983037207 4:162881753-162881775 GGAATATTAGTAAACAATTTAGG - Intergenic
983127818 4:163976054-163976076 AGAATGTCAGAAAACTGTTTGGG + Intronic
983755114 4:171325714-171325736 AGAATGATAGAATGGACTTTGGG + Intergenic
984349953 4:178577637-178577659 AGAAAGTAAGAAAACATTTTGGG + Intergenic
984842783 4:184083386-184083408 TGCATGTTAGAAAACCCCTTGGG + Intergenic
986918344 5:12653696-12653718 AGAATGATACAATATACTTTGGG + Intergenic
987130820 5:14858283-14858305 AGAATGATACAAAGGACTTTGGG - Intronic
987362648 5:17121151-17121173 TGAAAGTGAGTAAACACTTTGGG + Intronic
987437990 5:17921534-17921556 AAAACGGTAGAAAACAGTTTTGG + Intergenic
987713030 5:21528461-21528483 AGAATATAAGAAAATACTTTTGG + Intergenic
988022676 5:25643380-25643402 TTTATGTTAGAAAACACATTTGG + Intergenic
988107152 5:26766575-26766597 AGAATATTAGAAGATAATTTAGG - Intergenic
988635636 5:32980852-32980874 AGAAGGCAAGAAAACATTTTTGG + Intergenic
989006679 5:36822194-36822216 AGAATGATAGAATGGACTTTGGG - Intergenic
989200699 5:38760071-38760093 AGAATGATAGAATGGACTTTGGG + Intergenic
989338128 5:40342819-40342841 AGAATGATAAAATGCACTTTGGG + Intergenic
989847950 5:46169824-46169846 AGAATGTTAGAAGAGATATTTGG + Intergenic
990147709 5:52781354-52781376 AGAATGTTACTGAACACTTTGGG - Intergenic
990244254 5:53848235-53848257 AAAATATTAGAAAACTGTTTTGG + Intergenic
990503282 5:56418977-56418999 AAAATGTTAGAAGACAACTTTGG + Intergenic
990553449 5:56907947-56907969 AGAATGTTAGCAAACTCTAGAGG - Intergenic
991007172 5:61840863-61840885 AGAAGGGCAGCAAACACTTTAGG - Intergenic
991023542 5:62006290-62006312 AGTATTTGAGAAATCACTTTGGG - Intergenic
991353302 5:65742069-65742091 AAAATGTTAGAAACTACTTAAGG - Intronic
991420809 5:66439348-66439370 AGCATCTTAGAAAGAACTTTAGG - Intergenic
992840656 5:80688395-80688417 ATCATGTTAGATAATACTTTTGG - Intronic
993439132 5:87933733-87933755 ATAATGTAAGATTACACTTTGGG + Intergenic
993503718 5:88688702-88688724 AGAATTTTAAAAAACAATTTTGG - Intergenic
993892263 5:93488755-93488777 AGAATGATTTAAAATACTTTGGG - Intergenic
994036621 5:95209139-95209161 AGAATGTTGGAAGACAATTGGGG - Intronic
994682030 5:102899998-102900020 TGAATGTAAGAAGACATTTTTGG + Intronic
994854672 5:105101880-105101902 ATAGGGTTAGAAAATACTTTTGG + Intergenic
995095460 5:108230761-108230783 AGAATGATAGAATGGACTTTGGG + Intronic
995237093 5:109841318-109841340 AGAATGATAGAATGGACTTTGGG - Intronic
995390554 5:111636016-111636038 AGAATGTTGGAAATCATTTCTGG + Intergenic
995862267 5:116653299-116653321 AGAATGAAAGTAAACACTTATGG + Intergenic
996156006 5:120101635-120101657 AGAATATTATAAAACACTAATGG - Intergenic
996429241 5:123353579-123353601 TGAATTTTAGTAAACATTTTAGG - Intronic
996673030 5:126141493-126141515 TGAATGTAAAAGAACACTTTGGG + Intergenic
996682124 5:126239040-126239062 AGAATGTTTGATGACACTTAGGG - Intergenic
996865632 5:128118537-128118559 AGAATGATATAATAGACTTTGGG + Intronic
996882454 5:128314934-128314956 AGGATTTTAGAAACCATTTTTGG - Intronic
997502790 5:134390299-134390321 AGAATATGAGAAAAGAGTTTCGG + Exonic
997775400 5:136600012-136600034 AGAATGATAGAATGTACTTTGGG - Intergenic
998076561 5:139241445-139241467 AGATTGTAGCAAAACACTTTGGG + Intronic
998742105 5:145215745-145215767 AGAATGATAGAATGGACTTTGGG + Intergenic
998813283 5:145987358-145987380 AGAATGATACAATAGACTTTGGG - Intronic
998840401 5:146247578-146247600 AGAATGTGAGAAAATTCTTTAGG - Intronic
999914237 5:156239612-156239634 AATATGTTAGAAAACACTTAGGG + Intronic
999930358 5:156425734-156425756 AGAATGATATAAAGGACTTTAGG - Intronic
999986141 5:157007324-157007346 ACAATGGTAGAACACACATTGGG + Intergenic
1000144058 5:158435965-158435987 AGAGTGTTAGAAAGGACTTGTGG + Intergenic
1000988380 5:167885982-167886004 AGAATGTTAGAAAGGGCTTGTGG - Intronic
1001343051 5:170864674-170864696 AGAATGTTAGGAAAAATTTAAGG + Intronic
1001927401 5:175648404-175648426 AGAATGGGAGAGAACATTTTGGG - Intergenic
1002024843 5:176389644-176389666 AGGATTTTTGAAAAAACTTTCGG - Exonic
1003147338 6:3519735-3519757 AGAATTTGAGAAAACCTTTTTGG - Intergenic
1003300634 6:4878915-4878937 AAAATGTTAGAAAATACTGTGGG - Intronic
1004703712 6:18103178-18103200 AGGAAGTTACAAAACACTATGGG + Intergenic
1004711761 6:18177976-18177998 TGAATATTAGAAAACACTGTTGG - Intronic
1005704352 6:28436658-28436680 TGAAGGTAAAAAAACACTTTGGG + Intronic
1006953825 6:37849053-37849075 AGAATAATAGAAGACACTATTGG - Intronic
1007894256 6:45333523-45333545 AACATGTTATCAAACACTTTAGG + Intronic
1008121208 6:47619246-47619268 AGAATGATAGAACAGACTTTGGG - Intronic
1008161271 6:48079152-48079174 TGAATGTAAGCATACACTTTTGG - Intergenic
1009003692 6:57753450-57753472 AGAATATAAGAAAATACTTTTGG - Intergenic
1009371993 6:62916668-62916690 AGAATCTTAGAAAACAACCTAGG + Intergenic
1009389411 6:63127599-63127621 AGAATGATACAATAGACTTTGGG - Intergenic
1009506364 6:64485233-64485255 GAAATGTTAGAGAACCCTTTAGG + Intronic
1009570343 6:65375935-65375957 AGCAAGTTGGAAAACACTTCAGG + Intronic
1009589522 6:65648523-65648545 AGAATGATACAATAGACTTTGGG + Intronic
1009593922 6:65709910-65709932 AGAATCTTAGAAAATAATCTAGG + Intergenic
1009614573 6:65989063-65989085 AGAATGTAAGAAAACAAAATTGG - Intergenic
1010135772 6:72551297-72551319 ACTGTGTAAGAAAACACTTTTGG - Intergenic
1010401971 6:75456160-75456182 ACAATGTCTGGAAACACTTTTGG + Intronic
1011153472 6:84301298-84301320 GTAATGTTAGAAAATACATTTGG + Intergenic
1011327623 6:86167724-86167746 AGAATGATACAATAGACTTTAGG + Intergenic
1011687557 6:89835874-89835896 AGAATGTGAGAATAAAGTTTAGG - Intronic
1012395929 6:98797106-98797128 AGAATGATACAATAGACTTTGGG + Intergenic
1012744957 6:103074586-103074608 AGAATGATACAAAGGACTTTGGG - Intergenic
1012761360 6:103306811-103306833 AGAATGATAGAATAGACTTTGGG + Intergenic
1013018748 6:106188275-106188297 AGAATATTTGAAAACATTTCCGG + Intronic
1013974009 6:116056141-116056163 AGTATGTTAGACAACACCTAAGG + Intronic
1014304354 6:119721848-119721870 AGAATGATACAATAGACTTTGGG - Intergenic
1014848308 6:126307760-126307782 AGAATGGAGGAAAAAACTTTTGG + Intergenic
1014859094 6:126441627-126441649 AGAATGATAGAAGGGACTTTAGG - Intergenic
1015287325 6:131501626-131501648 AGAATCTTAGAGAAAACTATGGG + Intergenic
1015304342 6:131690222-131690244 AAAATGTTATAAAACAGTTTCGG + Intronic
1016040851 6:139430667-139430689 AGAATTTAGGAAAGCACTTTGGG + Intergenic
1016176954 6:141091173-141091195 AAAATGTTTTAAAATACTTTTGG - Intergenic
1016180602 6:141142987-141143009 AGAATGATAGAATGGACTTTGGG - Intergenic
1016500631 6:144717225-144717247 AGAAATTTAGAAAACAGTTTTGG + Intronic
1016592442 6:145761607-145761629 AGGAAGGTAGAAAACACTTTAGG - Intergenic
1017124442 6:151052209-151052231 AGACAGTTAGAAATCAATTTTGG + Intronic
1017355694 6:153504964-153504986 AGAATGTCAGAACACACAATTGG - Intergenic
1017391869 6:153948817-153948839 AGAATGATATAATAAACTTTGGG + Intergenic
1018667610 6:166153826-166153848 AGTATGCTAGAAAACAGATTGGG + Intergenic
1019100920 6:169628571-169628593 ATACTGTTAGATAAAACTTTTGG - Intronic
1019441297 7:1048638-1048660 AGACTGTTTGATAGCACTTTGGG + Intronic
1020439737 7:8204554-8204576 AGAATGTTAGGGAAAACTCTAGG + Intronic
1020650254 7:10866252-10866274 AGAATATTTAAAAACACTTCAGG - Intergenic
1020714894 7:11660374-11660396 AAAATGTTATAAAACAATTCTGG + Intronic
1020986006 7:15135218-15135240 AGATTGGTAGAAAAAACTATAGG - Intergenic
1021801036 7:24306546-24306568 AGAATGTGAGACAAGACTGTGGG + Intergenic
1021925358 7:25529220-25529242 AGAAAGATAGAAAACACTTGGGG - Intergenic
1023015368 7:35964101-35964123 AGAATGCTGGCAAACACATTTGG + Intergenic
1023407930 7:39855716-39855738 TGAATGTTACCAAACATTTTAGG - Intergenic
1024065575 7:45730593-45730615 AGAATGCTGGCAAACACATTTGG - Intergenic
1024107932 7:46111945-46111967 AGAATGTTGTAAAAGACTTTGGG + Intergenic
1024593811 7:50915450-50915472 AGGTTGTTAGAAAACACTTAAGG - Intergenic
1025240129 7:57264844-57264866 AGAATGTTAGAAAAAACCCATGG - Intergenic
1025532231 7:61902692-61902714 AGAATATGAGAAAAAACATTTGG + Intergenic
1026235783 7:68526129-68526151 AGAATGATACAATAGACTTTGGG + Intergenic
1027592052 7:80130096-80130118 AGAATGGCAGAAAATACTATGGG + Intergenic
1027749333 7:82122156-82122178 AGAAAGTTAAAAAACACTGTAGG + Intronic
1027807988 7:82853970-82853992 AGAAATTTAAAAAATACTTTAGG + Intronic
1028577328 7:92366600-92366622 AGAATGTTTGAAAACATGATAGG - Intronic
1028577396 7:92367149-92367171 AGAATGTTTGAAAACATGATAGG + Intronic
1028585299 7:92446509-92446531 AAACTGTTGGAAAACAGTTTTGG - Intergenic
1028895418 7:96035794-96035816 AGAATGTGATAACAGACTTTCGG - Intronic
1028939773 7:96508377-96508399 ACAATGTAATAAAACACTTCTGG + Intronic
1030392790 7:108947821-108947843 AGACTGTTGGAAAAGTCTTTGGG - Intergenic
1030423618 7:109342288-109342310 ATAATGTAAGAAAACAACTTGGG + Intergenic
1030768764 7:113446206-113446228 AGAATGTTTGAAAAAAAATTGGG + Intergenic
1030942574 7:115672201-115672223 AGAATTTTAAGAAACATTTTTGG + Intergenic
1031030124 7:116725342-116725364 AGAATGTTTCAAAACTGTTTAGG + Intronic
1031378708 7:121059560-121059582 AAAATGTAAGAAAACACTGGAGG - Intronic
1032911809 7:136440882-136440904 AGAATGATACAATAGACTTTGGG - Intergenic
1033001416 7:137509244-137509266 AAAATGTTAGAAAAATCATTGGG + Intronic
1033961093 7:146913927-146913949 AGAATGTTACAAGGGACTTTGGG - Intronic
1034080343 7:148271404-148271426 GCAATGTTAGAAGACATTTTTGG - Intronic
1034370202 7:150588517-150588539 AGAATGATATATAACCCTTTGGG + Intergenic
1034376645 7:150650652-150650674 AGAATGATACAATAGACTTTGGG - Intergenic
1035963212 8:4159907-4159929 AGAATGATATAAAAAACTTTCGG + Intronic
1036002044 8:4616998-4617020 AACATGTTAGAAATCACTTATGG - Intronic
1036097393 8:5739075-5739097 AGAATGATATATAACCCTTTGGG + Intergenic
1036260690 8:7237440-7237462 GGAATGTAAGAAATCACTTCTGG + Intergenic
1036305920 8:7602082-7602104 GGAATGTAAGAAATCACTTCTGG - Intergenic
1036312728 8:7695996-7696018 GGAATGTAAGAAATCACTTCTGG + Intergenic
1036356768 8:8050067-8050089 GGAATGTAAGAAATCACTTCTGG - Intergenic
1036831576 8:12024389-12024411 CGAATGTAAGAAATCACTTCTGG + Intergenic
1036901799 8:12675195-12675217 GGAATGTAAGAAATCACTTCTGG + Intergenic
1038103529 8:24407713-24407735 AGAATGATATAATAGACTTTGGG - Intergenic
1038969608 8:32618391-32618413 AGAATGTAAAAAAATACTTTTGG + Intronic
1039016362 8:33153765-33153787 AAAATGTTAGTAAAAACGTTGGG - Intergenic
1039643083 8:39245272-39245294 AGAATGATACAATAGACTTTGGG + Intronic
1039720165 8:40155378-40155400 AGCATTTTGAAAAACACTTTAGG - Intergenic
1040123773 8:43712431-43712453 AGAATATGTGAAAAAACTTTTGG + Intergenic
1040131344 8:43800579-43800601 AGAATGTTTGAAGAGACTTTGGG + Intergenic
1040297138 8:46158712-46158734 AGCAGGTTAGAACACTCTTTTGG - Intergenic
1041220842 8:55649253-55649275 ATCATCTGAGAAAACACTTTGGG - Intergenic
1041293212 8:56327396-56327418 AGAATGATACAATAGACTTTGGG - Intergenic
1041365715 8:57101767-57101789 AGAATGATACAAAGAACTTTGGG - Intergenic
1041497921 8:58507503-58507525 AGAAAATGAGAAAACATTTTTGG + Intergenic
1041517788 8:58720572-58720594 TGAATTTTATCAAACACTTTTGG - Intergenic
1041546644 8:59052260-59052282 AATATGTGAAAAAACACTTTTGG - Intronic
1041594360 8:59629737-59629759 AGAGTAATAGGAAACACTTTGGG + Intergenic
1042008978 8:64218071-64218093 AGAATATTTGAAAATATTTTTGG + Intergenic
1042182564 8:66106155-66106177 ATAATTTTAGAAAGCAGTTTTGG - Intergenic
1042248423 8:66730985-66731007 AGAAAATTAAAAAATACTTTTGG - Intronic
1042511099 8:69612022-69612044 AGAATGATATAATAAACTTTGGG - Intronic
1042858425 8:73290722-73290744 AAACCATTAGAAAACACTTTAGG + Intronic
1042901974 8:73737700-73737722 ATAGTGTTAGAAAATACTTTTGG - Intronic
1042996012 8:74699604-74699626 AGAATGATACAAAGGACTTTGGG + Intronic
1043099624 8:76025254-76025276 AGAGTGATAGAAACCATTTTGGG - Intergenic
1043766202 8:84135345-84135367 ATAACATTAGAAAACACTGTTGG + Intergenic
1044808311 8:96031324-96031346 AGAATGTGTGAGAACATTTTAGG - Intergenic
1045164089 8:99583244-99583266 AGAATGTTAGAGAAAAATCTAGG + Intronic
1045369820 8:101511766-101511788 AGAATGATAGAATAAAATTTAGG - Intronic
1045590800 8:103594300-103594322 AGAATGCTAGATTACACTTAGGG - Intronic
1046860109 8:119081711-119081733 AGAATGTCAGAAAATAATATGGG + Intronic
1047401383 8:124551022-124551044 AGAATGTGACAACACACCTTGGG - Intronic
1047593290 8:126350041-126350063 AGAATGTATGCAACCACTTTAGG + Intergenic
1048202616 8:132388517-132388539 ATAATATTAGAAAACAGTTGAGG + Intronic
1050028546 9:1361255-1361277 AGAATGGAAAAAAACACATTGGG - Intergenic
1050592873 9:7178353-7178375 AGAATGTAAGGGAACATTTTGGG + Intergenic
1050762823 9:9094487-9094509 AGAATGATATAACAGACTTTGGG + Intronic
1051126813 9:13814100-13814122 TGGAAGTTAGAAGACACTTTTGG - Intergenic
1052091733 9:24337055-24337077 AGAATGATACAATAGACTTTGGG - Intergenic
1052620458 9:30902102-30902124 AAAATGTTAGAGAAAAGTTTTGG - Intergenic
1053089015 9:35255806-35255828 ACAAGATTAGAAATCACTTTAGG - Intronic
1053116023 9:35503283-35503305 AGAATGATATAATAGACTTTGGG - Intronic
1053401022 9:37822610-37822632 AGAATGATACAATAGACTTTGGG + Intronic
1053493098 9:38526204-38526226 GGAATATTAAAAAACAATTTGGG - Intergenic
1053878978 9:42573181-42573203 AGAATTTAAGAAAACAATCTCGG + Intergenic
1054232714 9:62528516-62528538 AGAATTTAAGAAAACAATCTCGG - Intergenic
1055070141 9:72157630-72157652 AGAATGAGAGAAAACAGTTAAGG - Intronic
1055120255 9:72651929-72651951 AGAATGTTACAATGGACTTTGGG - Intronic
1055206171 9:73733185-73733207 AGAATATTTGGAAACATTTTTGG + Intergenic
1055310104 9:74970266-74970288 AGAATGATATAATGCACTTTGGG + Intergenic
1055521298 9:77083570-77083592 TGACTGTTAGAAAACTCTTTCGG - Intergenic
1055963037 9:81838653-81838675 AGAAAGTTAGAGAACACTAAAGG - Intergenic
1056322237 9:85446511-85446533 AGAATGATACAATATACTTTGGG - Intergenic
1056500148 9:87200900-87200922 AGAATGATACAACAGACTTTGGG + Intergenic
1056708373 9:88970479-88970501 AGAATGGTATAAGACATTTTGGG - Intergenic
1056897002 9:90560295-90560317 AGAATGATATAAAGGACTTTAGG + Intergenic
1057461948 9:95271085-95271107 ACAATGTTTGAAGACATTTTTGG + Intronic
1057673333 9:97115117-97115139 GGAATATTAAAAAACAATTTGGG - Intergenic
1059135753 9:111804481-111804503 AGAGTGTTAGAAAATATTTTAGG - Intergenic
1059491026 9:114667453-114667475 ACAATGCCAGAAAACACTTGTGG - Intergenic
1059809750 9:117842675-117842697 AGAATGTTTGATAACAATTGTGG + Intergenic
1060845374 9:126832741-126832763 AGAATGTTCTCAAACACTCTTGG - Exonic
1061171439 9:128958548-128958570 ATCATGCTAGAAAACATTTTTGG + Intronic
1203618717 Un_KI270749v1:97219-97241 AGAATGATATAATAGACTTTGGG + Intergenic
1185934389 X:4239385-4239407 AGAATGATAGAATGAACTTTGGG + Intergenic
1186597043 X:10993470-10993492 AGAATTTTAAAGAGCACTTTCGG + Intergenic
1186899528 X:14038643-14038665 GCAATGTCTGAAAACACTTTTGG - Intergenic
1186968895 X:14818412-14818434 AGAACATTAGAAAACACTGGCGG + Intergenic
1187513775 X:19946603-19946625 ATGAAGTTAGAAAACATTTTGGG - Intronic
1188098498 X:26052282-26052304 AGTATGTTTGTAGACACTTTGGG + Intergenic
1188122624 X:26327901-26327923 AGGATGGTAGAAAATAATTTGGG - Intergenic
1188249656 X:27876853-27876875 CTAATGATAGAAAACATTTTTGG - Intergenic
1188341153 X:29003494-29003516 AGAATCTCAGAAATCACCTTCGG - Intronic
1188719326 X:33504028-33504050 AGAATGATATAATAGACTTTGGG + Intergenic
1188807470 X:34609374-34609396 AGAAAGTTAGATAACAATCTGGG - Intergenic
1189128798 X:38477187-38477209 AGAATGATAGAATGGACTTTGGG - Intronic
1190000293 X:46679721-46679743 AGAATGTTGAAAAATACTTCTGG + Exonic
1193006825 X:76628534-76628556 AGAATAATAGAATGCACTTTAGG + Intergenic
1193265087 X:79458229-79458251 AGGCTGTTAGAAACTACTTTAGG - Intergenic
1193386365 X:80876694-80876716 AGAATGATATAATAGACTTTGGG + Intergenic
1193874847 X:86849634-86849656 AGAATGATATAATGCACTTTGGG - Intergenic
1194354344 X:92862685-92862707 AGAATGATATAATAAACTTTGGG + Intergenic
1194381551 X:93198146-93198168 AGAATGATAAAATAGACTTTGGG + Intergenic
1194526339 X:94982559-94982581 AGTTTCTTAAAAAACACTTTGGG + Intergenic
1195498833 X:105570140-105570162 AGAATGTTATAATGAACTTTGGG - Intronic
1195629207 X:107036574-107036596 AAAATGCAAGGAAACACTTTTGG + Intergenic
1195823454 X:108971459-108971481 AGAATGATAGAATAGACTTTGGG + Intergenic
1195865232 X:109425618-109425640 AGAATGATACAAAGGACTTTGGG + Intronic
1195881671 X:109599389-109599411 CGAATGACAGAAAACAATTTTGG + Intergenic
1196590058 X:117476541-117476563 AGAATGATAGAATGTACTTTGGG - Intergenic
1196994006 X:121360889-121360911 AGAATGATACAATAAACTTTGGG - Intergenic
1197048734 X:122032165-122032187 AGAATGTTACAATGAACTTTGGG - Intergenic
1197060888 X:122180065-122180087 AAAATATAAGAAAACTCTTTTGG + Intergenic
1197070302 X:122288930-122288952 AGAATGATACAATAGACTTTGGG + Intergenic
1197447482 X:126568103-126568125 AGCATGTTAAAAAACAACTTTGG - Intergenic
1197675335 X:129323858-129323880 GAAATGAAAGAAAACACTTTGGG - Intergenic
1197751893 X:129970200-129970222 AGAATGATACAAAGGACTTTTGG - Intergenic
1198046138 X:132904827-132904849 AGCAGGTTAGAAAACAGTTTGGG - Intronic
1198754572 X:139969556-139969578 AGATTGTTTGAAAAATCTTTGGG - Intergenic
1198781735 X:140245056-140245078 AGAATGATACAATAAACTTTGGG - Intergenic
1199358376 X:146887129-146887151 TGACTCTTAGACAACACTTTTGG + Intergenic
1199547370 X:149020099-149020121 AGAAGGCTAGAAGACACATTTGG - Intergenic
1200662697 Y:5979715-5979737 AGAATGATATAATAAACTTTGGG + Intergenic
1201295040 Y:12455122-12455144 AAAAAGCAAGAAAACACTTTTGG - Intergenic
1201316249 Y:12649406-12649428 AGAATGATGCAACACACTTTGGG + Intergenic
1201715656 Y:17042331-17042353 AGAATGATAGAATGGACTTTGGG + Intergenic
1201776804 Y:17674481-17674503 AGAATCTGAGAAGAGACTTTGGG - Intergenic
1201824752 Y:18231511-18231533 AGAATCTGAGAAGAGACTTTGGG + Intergenic
1202023226 Y:20490364-20490386 AGAATATTACAAGACATTTTAGG - Intergenic