ID: 1098167745

View in Genome Browser
Species Human (GRCh38)
Location 12:67715460-67715482
Sequence CATCCCAGGATTGCAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098167745_1098167747 -6 Left 1098167745 12:67715460-67715482 CCAGTGGCTGCAATCCTGGGATG 0: 1
1: 0
2: 3
3: 22
4: 244
Right 1098167747 12:67715477-67715499 GGGATGCACAGTGTTCTCTCTGG 0: 1
1: 1
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098167745 Original CRISPR CATCCCAGGATTGCAGCCAC TGG (reversed) Intergenic
901939570 1:12651749-12651771 CATCCCAGCCTCCCAGCCACGGG + Intronic
903535853 1:24065834-24065856 CCTCCCTGGCTTGCAGCCAAAGG + Intronic
904770258 1:32877298-32877320 CATCCCAGGTTGGCAGGCACTGG - Intergenic
906183465 1:43841129-43841151 CAGCCCATGAGAGCAGCCACAGG - Intronic
907099074 1:51811345-51811367 CATCCCTGGCTTCCACCCACTGG + Intronic
908696648 1:66849956-66849978 CATCCGAGGATTGGAGGAACGGG + Intronic
910049341 1:82957268-82957290 CATCTCAGGGTTGCTGCCAAAGG - Intergenic
911315657 1:96353711-96353733 AATGCCAGGATTTCACCCACAGG + Intergenic
912192048 1:107352089-107352111 CAACCCATGAAAGCAGCCACAGG - Intronic
912776174 1:112507915-112507937 CCTCCCAGGATAGCAGGTACGGG - Intronic
914370387 1:147019612-147019634 CATGCAAGAAGTGCAGCCACCGG - Intergenic
915031456 1:152883445-152883467 CAGCCCAGGTATGCAGCCCCTGG - Intronic
915216151 1:154342018-154342040 CATCCCAGCAGCACAGCCACGGG - Intronic
916248569 1:162712559-162712581 CATCTCAGGACTGCCCCCACTGG - Intronic
916465753 1:165073189-165073211 CATACCAGCATTGCTGCCCCAGG - Intergenic
917114368 1:171587195-171587217 CATAGCATGATTGCAACCACAGG + Exonic
918347075 1:183615599-183615621 CATCTCAGGGTTGCTGCCAAAGG - Intergenic
919273784 1:195385476-195385498 CAGCCCATGAAAGCAGCCACAGG + Intergenic
919775109 1:201189340-201189362 CCTCCCAGGAGTGCAGTCCCAGG - Intergenic
920199491 1:204250769-204250791 CATCCCAGGCTTCCAGCCAGGGG - Intronic
920503508 1:206500342-206500364 CCTCACAGGATTGCTGCAACTGG + Intergenic
1063018868 10:2105764-2105786 CATCTCAGGAGTGCAGCCAGTGG - Intergenic
1063074156 10:2698113-2698135 CTTCCCCGAATTTCAGCCACGGG - Intergenic
1064389867 10:14932729-14932751 CAACTTAGGATTGCAGCCTCAGG + Intronic
1064394883 10:14973876-14973898 CAACTTAGGATTGCAGCCTCAGG + Intronic
1064464139 10:15562703-15562725 CCTCCCAGGGTTTCTGCCACTGG - Intronic
1067851757 10:49759182-49759204 TGGCCCAGGATTGCAGTCACAGG - Intronic
1068614148 10:59093632-59093654 ATTCCCAGGATTTCAGACACAGG + Intergenic
1070006231 10:72426819-72426841 CACTCCAGGAGTGCACCCACAGG - Intronic
1075676151 10:124296958-124296980 CCTCCCAGCATGGCAGCCTCAGG + Intergenic
1076371868 10:129960327-129960349 CTTCCCAGGAGGGCAGCCCCGGG - Intronic
1076486536 10:130823287-130823309 CTTCCCAGGATTGCAGAAGCTGG + Intergenic
1076504290 10:130961854-130961876 AATACCAGGATTGCTCCCACTGG + Intergenic
1076567376 10:131407997-131408019 CAAGCCAGCATTTCAGCCACAGG + Intergenic
1076647082 10:131961061-131961083 CAAGCCAGGAATCCAGCCACAGG + Intergenic
1076833045 10:133006541-133006563 GATCTCAGGCTTGCAGCCTCTGG - Intergenic
1077219365 11:1408580-1408602 CCTGTCAGGATGGCAGCCACAGG - Intronic
1077246919 11:1544131-1544153 GAGCCCATGACTGCAGCCACGGG - Intergenic
1081045564 11:38269533-38269555 CAGCCCATGAGTGCAGCCATGGG - Intergenic
1081437329 11:43041197-43041219 CATCCCAGGCTTGGAGGCTCAGG - Intergenic
1083300512 11:61737579-61737601 CATCCCAGGAGTGCAGGAGCAGG + Intronic
1083965674 11:66042447-66042469 CCTCCCAGGAGTCCAGCCAGGGG - Exonic
1084355513 11:68635663-68635685 CGTCTCAGGATTGCTGCCAAAGG - Intergenic
1084791690 11:71478893-71478915 CATCCCAGGGTCTCAGACACAGG - Intronic
1085281786 11:75335729-75335751 CAGCCCAGGATTCCAGGCCCAGG - Intronic
1085341144 11:75732379-75732401 CATGCCTGGACTGCAGCCACAGG - Intronic
1085600813 11:77854656-77854678 CAGCCCACGAAAGCAGCCACAGG - Intronic
1086252048 11:84827576-84827598 CATGGCAGGATGGCAGCCAGAGG + Intronic
1087336638 11:96852160-96852182 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1088913534 11:114209912-114209934 AGTCTCAGGAATGCAGCCACAGG + Intronic
1089011092 11:115132425-115132447 CATCCCAGGTTTCCAGCCCTGGG + Intergenic
1089105246 11:115997660-115997682 CATCCCAGGATGCCAGTGACTGG + Intergenic
1089951990 11:122536410-122536432 CAGCCCATGAGAGCAGCCACAGG + Intergenic
1091841318 12:3623411-3623433 CATCCCAGGACTGCAGACACTGG + Intronic
1094419543 12:30256116-30256138 CATGCCAGGAATGCACCCATTGG + Intergenic
1095796414 12:46224215-46224237 CATCCCTGACTTGCAGCCTCAGG + Intronic
1096117334 12:49062539-49062561 CCTCCCAGGTTTGCACCCAGAGG + Intergenic
1098167745 12:67715460-67715482 CATCCCAGGATTGCAGCCACTGG - Intergenic
1098319883 12:69232446-69232468 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1102741479 12:115211240-115211262 TGTCCCAGGCTTGCAGCCACTGG - Intergenic
1103662137 12:122528787-122528809 CATCCCTAGATTGCACCTACAGG - Intronic
1103874033 12:124113608-124113630 CACCCCAGCATGGCAGGCACAGG - Intronic
1104328851 12:127825629-127825651 CAGCCCAGGACAGAAGCCACTGG - Intergenic
1104898713 12:132176487-132176509 CAGCCCAGGAGTGCGGCCTCCGG - Intergenic
1105072393 12:133242651-133242673 CATTCCAGGATTTCAGCCAGAGG + Intergenic
1105422991 13:20269641-20269663 CCGCCCAGCATGGCAGCCACTGG - Intergenic
1106130615 13:26936371-26936393 CAACCCATGAAAGCAGCCACAGG + Intergenic
1106506640 13:30376317-30376339 CATCCCAGGGTTCCAGGCTCTGG + Intergenic
1108506769 13:51119199-51119221 CACTCCATGCTTGCAGCCACAGG - Intergenic
1109441262 13:62378630-62378652 CATCACAGGATTGCAGAATCAGG + Intergenic
1111217451 13:85163072-85163094 CAACCCATGACAGCAGCCACGGG - Intergenic
1111908528 13:94283880-94283902 CAGCCCAGGATGGCAGCCTCTGG + Intronic
1113191318 13:107750178-107750200 CGTCCCAGTGTGGCAGCCACTGG - Intronic
1114821094 14:26019943-26019965 CATCCCAGGAAGGCAGACACTGG + Intergenic
1115939476 14:38592074-38592096 CATCCCAGAACTCCAGCAACTGG - Intergenic
1117690141 14:58298183-58298205 GAACCCAGAATTGCAGCCAGGGG - Intergenic
1121635981 14:95454165-95454187 CATCCCAGGGTTGCAGTCCCAGG + Intronic
1122044450 14:99013062-99013084 CATCCCCAGATAGCACCCACTGG - Intergenic
1122521240 14:102345346-102345368 CCAACCAGGGTTGCAGCCACAGG - Intronic
1123817763 15:23996979-23997001 GATCCAAGGGTTGCAGCCAATGG - Intergenic
1124692014 15:31831729-31831751 GAGCCCAGGATTCTAGCCACAGG + Intronic
1128508656 15:68299676-68299698 CATCCTGGGATTGAAGCCAGGGG + Intronic
1128576355 15:68777966-68777988 CATCCCATGCTTGGAACCACAGG + Intergenic
1128980720 15:72183904-72183926 CATCCCTGGGATGCAGTCACCGG - Intronic
1129137265 15:73565670-73565692 CACCTCAGTATTACAGCCACTGG + Intronic
1129411698 15:75354018-75354040 CGTCCCAGGGTTGCAGCTAGTGG + Intronic
1130437769 15:83919206-83919228 CATCCAAGGATTGAAGCCAGGGG + Intronic
1132515264 16:363132-363154 CATCCCAGGACAGCAGGCAGTGG + Intergenic
1132981299 16:2739828-2739850 CACTCAAGGACTGCAGCCACTGG - Intergenic
1133263851 16:4571232-4571254 CATCCCTGGGTAGGAGCCACTGG - Intronic
1133417238 16:5616252-5616274 CTTCCCAGGTTTCCAGCCGCGGG - Intergenic
1135790892 16:25394472-25394494 TAATCCAGCATTGCAGCCACTGG - Intergenic
1138595893 16:58028738-58028760 CCTCCCAGGGTGGAAGCCACAGG + Intronic
1143587618 17:7858436-7858458 CAGGCCAGGATATCAGCCACTGG + Exonic
1144223170 17:13118575-13118597 CATCCCAGGATGACAGCAACAGG - Intergenic
1144580533 17:16456546-16456568 CTTCTCAGGGTTCCAGCCACTGG - Intronic
1144733081 17:17539982-17540004 CACCCCAGGAGTGCAGGGACAGG + Intronic
1144886643 17:18467486-18467508 CATCCCAGAATGGCAGTCCCAGG - Intergenic
1144944856 17:18964661-18964683 AATGCCAGCCTTGCAGCCACAGG + Intronic
1145145569 17:20476822-20476844 CATCCCAGAATGGCAGTCCCAGG + Intergenic
1146648620 17:34592223-34592245 CTTCCCAGGAAAGCAGTCACAGG + Intronic
1147330272 17:39695256-39695278 CATCTCAGGAATGCAGGCCCAGG - Intronic
1147561398 17:41511512-41511534 CATCCCAGGAGAGCAGAAACAGG + Intergenic
1147729224 17:42587208-42587230 TATCCCTGGATTGCAATCACAGG - Intronic
1148698400 17:49574711-49574733 CGTGCCGGGGTTGCAGCCACGGG + Intergenic
1149602081 17:57899495-57899517 AATCCCAGTGCTGCAGCCACTGG - Intronic
1149754915 17:59178625-59178647 AGTCTCAGGATTGCTGCCACAGG + Intronic
1152046915 17:77942818-77942840 CACCCCAGGGTGGCAGCCCCTGG - Intergenic
1152830952 17:82496830-82496852 CAGCCCACGATGGCAGCAACAGG + Intergenic
1153159632 18:2189390-2189412 CATCCCATGATTGCAGAAAAAGG - Intergenic
1153513152 18:5877496-5877518 TAGCCCAGAATTGCAGCTACGGG - Intergenic
1157116734 18:44869262-44869284 CCTCAAAGGATTTCAGCCACAGG + Exonic
1158129780 18:54139867-54139889 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1159894843 18:73986363-73986385 AATGTCAGGATTGCAGGCACTGG + Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
925100229 2:1237950-1237972 CAGCCCAGGATGGCACCGACTGG + Exonic
925608580 2:5683999-5684021 CATGCCAGGATTCCAGCTGCTGG - Intergenic
925927880 2:8683332-8683354 CATCACAGGGTTGAAGGCACAGG - Intronic
926062577 2:9813548-9813570 GATCCCAGGACAGCACCCACAGG + Intergenic
927854279 2:26518088-26518110 GAAGCCAGGACTGCAGCCACAGG - Intronic
927899130 2:26806349-26806371 CATCCTAGGGTGGCACCCACTGG - Intergenic
929150032 2:38739169-38739191 CCTCCCAGTATTACAGGCACAGG - Intronic
930335311 2:50038343-50038365 AAGCCCAGGATAGGAGCCACAGG - Intronic
936075455 2:109398816-109398838 CCTCCCAGGCTGCCAGCCACAGG + Exonic
936837171 2:116722695-116722717 CAGCCCATGAGAGCAGCCACAGG - Intergenic
938279855 2:130056182-130056204 CAGCCCATGAGAGCAGCCACGGG + Intergenic
938330807 2:130446897-130446919 CAGCCCATGAGAGCAGCCACGGG + Intergenic
938359138 2:130674606-130674628 CAGCCCATGAGAGCAGCCACGGG - Intergenic
938435539 2:131281255-131281277 CAGCCCATGAGAGCAGCCACGGG - Intronic
940133860 2:150414034-150414056 CATCCCTGAATTCCAGCCAGTGG + Intergenic
942975849 2:182016083-182016105 AGTCTCAGGATTCCAGCCACTGG + Intronic
946024941 2:216665982-216666004 CTTCCCAGGAGGGCAGGCACGGG - Intergenic
946515045 2:220402642-220402664 CAACCCATGAAAGCAGCCACAGG + Intergenic
946893232 2:224298626-224298648 CATCTCAGGGTTGCTGCCAAAGG - Intergenic
947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG + Intergenic
948308597 2:236968591-236968613 CAGCCCAGGAATGAAGGCACTGG - Intergenic
949030543 2:241795010-241795032 ATTCCCAGTAGTGCAGCCACAGG + Intronic
1169081210 20:2798683-2798705 CAGCCCAGACTTGCAGCCCCTGG - Intronic
1169927444 20:10797520-10797542 CATCCAAGGTATGCACCCACAGG - Intergenic
1170122070 20:12922669-12922691 CAACCCATGAGAGCAGCCACAGG + Intergenic
1172497139 20:35395619-35395641 CATATCTGGGTTGCAGCCACAGG + Intronic
1173065008 20:39702348-39702370 CTTTCCAGGAATGCAGCCAGAGG - Intergenic
1177512109 21:22101198-22101220 CATCTCAGACTTGCAGCCTCTGG - Intergenic
1179186398 21:39088193-39088215 CATGCCAGGATCCCAGCCCCAGG + Intergenic
1179319951 21:40281031-40281053 CTTCCCAACATTGCAGCCAAGGG - Intronic
1179801235 21:43812362-43812384 CTTCCCAGGATTGCAGCGTTGGG + Intergenic
1181140265 22:20799406-20799428 CAGCCCAGGATTTTAACCACGGG + Intronic
1181563195 22:23717457-23717479 TAGCCCAGGGTTCCAGCCACAGG - Intergenic
1182242697 22:28929392-28929414 CATCCCAGGACTCTACCCACAGG + Intronic
1183275899 22:36897587-36897609 CAACCCAAGAGAGCAGCCACAGG + Intergenic
1184159832 22:42691702-42691724 CCTCCCGGGATTTCAGCCACAGG + Intergenic
1185058945 22:48595521-48595543 CGTCTCTGGATTGAAGCCACTGG + Intronic
1203324244 22_KI270737v1_random:102210-102232 CATCCCAGGGATGAAGCCACTGG + Intergenic
949612335 3:5715542-5715564 CAGCCCATGAGAGCAGCCACAGG + Intergenic
950883257 3:16340320-16340342 CTTCACAGGATGGCAGCCACAGG - Intronic
952955060 3:38551681-38551703 CCTTCCAGGATTGCGTCCACTGG + Intronic
953389103 3:42524286-42524308 CTTCCCATCATTGCAGCCAGAGG - Intronic
953492525 3:43363572-43363594 CATCCCAGGGCTGCAGCCTCCGG - Intronic
953929869 3:47000504-47000526 CTGACCAGGGTTGCAGCCACTGG + Intronic
957524173 3:81358471-81358493 CAGCCCATGAAAGCAGCCACAGG + Intergenic
957630470 3:82710953-82710975 CATCCCATGAAAGCAGCCAGGGG - Intergenic
959909230 3:111744898-111744920 CATAGCAGGATTGAATCCACAGG - Intronic
962162438 3:133013403-133013425 CAACCCATGAGAGCAGCCACAGG + Intergenic
962978910 3:140470374-140470396 CTTCCCAGGCTTTCAGCCCCAGG - Intronic
963579023 3:147100692-147100714 CATCCCAGCATTGTAGCCAAGGG + Intergenic
963777270 3:149452004-149452026 CAACCCATGAAAGCAGCCACAGG - Intergenic
964159683 3:153632030-153632052 CATTCCAAGATTTCTGCCACTGG - Intergenic
965404817 3:168255628-168255650 CAGCCCATGAAAGCAGCCACAGG - Intergenic
965697938 3:171428697-171428719 CAGCACAGAATTGCAGCTACTGG - Intronic
966065409 3:175815745-175815767 CCTCCCAGGATAGAAGCCACAGG + Intergenic
967601244 3:191391848-191391870 AATCCCAGGAATGCAAACACAGG - Exonic
967643876 3:191899153-191899175 CATCTCAGGGTTGCTGCCAAAGG + Intergenic
967883609 3:194318414-194318436 CAACCCATGAGAGCAGCCACAGG - Intergenic
968446385 4:654312-654334 CATCCCTGGAGTGCAGCAGCAGG - Intronic
968760265 4:2439202-2439224 CATCCCAGGGTTGCGGAAACTGG + Intronic
969043001 4:4315628-4315650 CATTCTAGGTTTGCAGCCTCTGG + Exonic
969289094 4:6227290-6227312 CATCCCAGGCTTGAAGACATGGG + Intergenic
969695661 4:8732866-8732888 CATCTGGGCATTGCAGCCACTGG + Intergenic
972406103 4:38748007-38748029 CAACCCATGAAAGCAGCCACAGG + Intergenic
972647642 4:40984228-40984250 CTTCCCAGGAGTGCAGCTCCTGG - Intronic
975840632 4:78470064-78470086 CATCCATGTATTCCAGCCACTGG - Intronic
976405851 4:84659694-84659716 CACCCCAGGATGGAGGCCACCGG - Intergenic
979805088 4:124961095-124961117 CAGCCCATGAAAGCAGCCACAGG - Intergenic
979805613 4:124966894-124966916 CATCCCAATATTGCAGCCAGTGG - Intergenic
980529077 4:134027251-134027273 CATCACAGGATTGCAATCTCAGG - Intergenic
983132802 4:164043031-164043053 CAGCCCATGAAAGCAGCCACAGG - Intronic
984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG + Intronic
984265376 4:177492238-177492260 CATCCCAGGAAGGATGCCACAGG + Intergenic
984556127 4:181216141-181216163 CATCCCTGGATTTCACCCATTGG + Intergenic
984567317 4:181346586-181346608 AATCCCAGGGTTTCAGCAACTGG + Intergenic
984918830 4:184746361-184746383 CATCCCAGGAGGGCAGGCATGGG + Intergenic
986025268 5:3844755-3844777 CATCCCAGTATTTTAGACACTGG + Intergenic
986115029 5:4765385-4765407 TTTCCCAGGAATGAAGCCACTGG + Intergenic
986783212 5:11085943-11085965 CATCCCAGAATGGCAGCCACAGG + Intronic
987263712 5:16229447-16229469 CAACCCAGGACGGCAGCCAAGGG + Intergenic
988579750 5:32458634-32458656 CAGCCCATGAAAGCAGCCACAGG - Intergenic
990328344 5:54700036-54700058 CAGCCCAGGTTTGCATCAACTGG - Intergenic
991122584 5:63032989-63033011 CAGCCCATGAAAGCAGCCACAGG + Intergenic
991204876 5:64038944-64038966 CAGCCCAAGAGAGCAGCCACAGG + Intergenic
993253095 5:85553422-85553444 CAGCCCATGAAAGCAGCCACAGG - Intergenic
993864410 5:93175149-93175171 AGTCCCAGGAGTGAAGCCACAGG - Intergenic
994283743 5:97938546-97938568 CAGCCCAGGAAAGCAGCCAAGGG + Intergenic
996833772 5:127768520-127768542 GATCTCAGAATTGCAGCCTCTGG + Intergenic
997100052 5:130958653-130958675 CAGCCCATGAAAGCAGCCACAGG + Intergenic
998039740 5:138944659-138944681 GTTCCCAGGATGGCAGCCAAAGG + Intergenic
998056830 5:139085733-139085755 CATCCCATGTTTTCAGCCCCTGG - Intronic
998382144 5:141733370-141733392 AAACCAAGGATTGCAGCCACCGG + Intergenic
999464137 5:151785547-151785569 CATCCCAGCATTTCATTCACGGG - Intronic
1000124378 5:158229310-158229332 CATCCCAGGGATGAAGCCAGTGG - Intergenic
1001375144 5:171249035-171249057 CATCCCACCATTGCCACCACTGG + Intronic
1003301856 6:4891337-4891359 CATCCCAGGGTTCCAGCAGCGGG - Intronic
1003569885 6:7248778-7248800 CCACCAAGGACTGCAGCCACAGG + Exonic
1004162028 6:13222660-13222682 CATCCCAGATTAGGAGCCACTGG - Intronic
1005813769 6:29534208-29534230 CAGCCCAGGACTGCTGCCCCGGG + Intergenic
1007402964 6:41614975-41614997 GAGCCCTGGATTGCAGCCATGGG - Intergenic
1008560097 6:52715281-52715303 CAACCAAGGATTCCATCCACTGG + Intergenic
1010360517 6:74987607-74987629 CAGCCCATGAAAGCAGCCACTGG + Intergenic
1011357915 6:86491566-86491588 CAACCCAGAATTGAATCCACTGG - Intergenic
1016052957 6:139549403-139549425 CATTCCAGAATTTCAGCCAATGG + Intergenic
1018592612 6:165443454-165443476 CAGCCCATGAAAGCAGCCACAGG - Intronic
1018643452 6:165926615-165926637 CAAGCCAGGCTTCCAGCCACTGG + Intronic
1019522093 7:1465715-1465737 CTGCCCAGGCCTGCAGCCACAGG + Intergenic
1019732713 7:2636717-2636739 CTCCCCAGGAATGCAGACACCGG - Intronic
1019797564 7:3063103-3063125 CAGCCCAGGATGGCAATCACAGG + Intergenic
1020588029 7:10096054-10096076 CATCCCAGAAGTGAAGTCACAGG - Intergenic
1021225626 7:18022530-18022552 CATCTCAGCATTTCAGCCTCTGG + Intergenic
1022472154 7:30688628-30688650 CTTCCCAGGTCTGCATCCACAGG - Intronic
1023741502 7:43285373-43285395 CATCCCAGGTTGGCAACCACTGG + Intronic
1026292271 7:69018424-69018446 CAACCCACGACAGCAGCCACAGG - Intergenic
1026988937 7:74572114-74572136 CATCCCACCATAGCACCCACTGG - Intronic
1033023043 7:137746515-137746537 CCTCCCAGGATGGCTGCCAGTGG - Intronic
1034965725 7:155389452-155389474 CATCCCAGCAAGGCAGCCCCAGG + Intronic
1035311985 7:157975233-157975255 CACCCCATGATTCCAACCACTGG + Intronic
1035338279 7:158143952-158143974 CTCCCCAGGACTGCAGCCCCGGG + Intronic
1039476069 8:37840021-37840043 CCTCCCAGGCTTCCAGCCTCCGG - Intronic
1040102721 8:43519591-43519613 CAGCCCATGAGAGCAGCCACGGG - Intergenic
1041271298 8:56111751-56111773 CTTCCCAGGATGGGAGCCAAGGG - Intergenic
1041400996 8:57445263-57445285 CATTCCAGGAATGCATCCCCTGG - Intergenic
1042172921 8:66009748-66009770 CATCCCAGGAAGGCTGCCAGAGG + Intergenic
1045258111 8:100546758-100546780 CAGCCCATGAAAGCAGCCACAGG + Intronic
1045749148 8:105460493-105460515 CATTCCAGCATCGCAGGCACGGG + Intronic
1049193155 8:141300032-141300054 CATCCCTGGAATGAAGGCACTGG + Intronic
1049222436 8:141434184-141434206 CATCCCAGGCCTGGAGTCACAGG - Intergenic
1051027054 9:12625465-12625487 CATGCCACATTTGCAGCCACCGG - Intergenic
1052879774 9:33594274-33594296 CACCCCATGAGAGCAGCCACAGG - Intergenic
1053496207 9:38549955-38549977 CACCCCATGAGAGCAGCCACAGG + Intronic
1053497949 9:38562310-38562332 CAGCCCATGAGAGCAGCCACGGG + Intronic
1056664196 9:88568147-88568169 TAGCCCAGCACTGCAGCCACAGG + Intronic
1057168622 9:92947512-92947534 CAGCCCAGGACTGAAGCCCCTGG - Exonic
1057481417 9:95447989-95448011 CTTTCCAGGATGGGAGCCACCGG - Intronic
1057676129 9:97137493-97137515 CACCCCATGAGAGCAGCCACAGG + Intergenic
1060222814 9:121773459-121773481 CAGCCCAGAACTGAAGCCACGGG + Exonic
1186499093 X:10036643-10036665 CATCATAGGCTTGAAGCCACAGG - Intronic
1186522366 X:10217413-10217435 CATCCCAGGGCTCCACCCACTGG + Intronic
1186782063 X:12922731-12922753 CATCCCAGGACAGCAGTCAAGGG - Exonic
1188163338 X:26829708-26829730 CATCCCCCCAATGCAGCCACAGG - Intergenic
1189310425 X:40014066-40014088 CACCCGAGGATCGCAGCCCCAGG - Intergenic
1192047405 X:67690440-67690462 CATCCCAGCATTGCTACCTCAGG + Intronic
1193029070 X:76878761-76878783 CTTCCCATGAAAGCAGCCACAGG - Intergenic
1193050701 X:77096434-77096456 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1194038810 X:88914921-88914943 CATCCCATGAAAGCAGCCATGGG - Intergenic
1194073038 X:89350936-89350958 CTTCCCAGGATTGAAGCTCCTGG + Intergenic
1194093325 X:89604061-89604083 CAACCCATGAGAGCAGCCACAGG + Intergenic
1195510775 X:105713085-105713107 CAGCCCATGAAGGCAGCCACAGG - Intronic
1196101133 X:111848231-111848253 CATCCCAGGTTTCCAGCCCCCGG + Intronic
1198924927 X:141779079-141779101 CATTCCAGGCTTCCAGGCACAGG + Intergenic
1200075091 X:153546857-153546879 CAACCCAGGGCTGCAGCCATCGG - Intronic
1200727276 Y:6686676-6686698 CTTCCCAGGATTGAAGCTCCTGG + Intergenic
1200728428 Y:6702451-6702473 CTTCCCAGGATTGAAGCTCCTGG + Intergenic