ID: 1098171521

View in Genome Browser
Species Human (GRCh38)
Location 12:67751803-67751825
Sequence CGCAGTGGCTGGAGGGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098171521_1098171529 17 Left 1098171521 12:67751803-67751825 CCTTCGGCCCTCCAGCCACTGCG No data
Right 1098171529 12:67751843-67751865 AGAGACAGCAGAAAGATTAAAGG No data
1098171521_1098171530 18 Left 1098171521 12:67751803-67751825 CCTTCGGCCCTCCAGCCACTGCG No data
Right 1098171530 12:67751844-67751866 GAGACAGCAGAAAGATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098171521 Original CRISPR CGCAGTGGCTGGAGGGCCGA AGG (reversed) Intergenic
No off target data available for this crispr