ID: 1098171540

View in Genome Browser
Species Human (GRCh38)
Location 12:67751915-67751937
Sequence GATTTACATTGGAGCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098171531_1098171540 20 Left 1098171531 12:67751872-67751894 CCTCTGAAATTGTATGAATCTGG No data
Right 1098171540 12:67751915-67751937 GATTTACATTGGAGCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098171540 Original CRISPR GATTTACATTGGAGCTTTGC TGG Intergenic
No off target data available for this crispr